Identification of lactic acid bacteria in the rumen and feces of dairy cows fed total mixed ration silage to assess the survival of silage bacteria in the gut

Abstract

The survival of silage lactic acid bacteria (LAB) in the gut of dairy cows was evaluated by examining the LAB communities of silage and gut contents. Samples were collected at 2 different research institutes (Mie and Okayama) that offered total mixed ration (TMR) silage throughout the year. Silage and feces were sampled in August, October, and November at the Mie institute, whereas silage, rumen fluid, and feces were sampled in June and August at the Okayama institute. Denaturing gradient gel electrophoresis using Lactobacillus-specific primers was performed to detect LAB species in the samples. The selected bands were purified for species identification and the band patterns were used for principal component analysis. Lactic acid was the predominant fermentation product in all the TMR silages analyzed, and the lactic acid level tended to be constant regardless of the sampling time and region. A total of 14 LAB species were detected in the TMR silage samples, of which 5 (Lactobacillus acetotolerans, Lactobacillus pontis, Lactobacillus casei, Lactobacillus suebicus, and Lactobacillus plantarum) were detected in the dairy cow feces. Most of the denaturing gradient gel electrophoresis bands for the feces samples were also detected in the rumen fluid, suggesting that any elimination of silage LAB occurred in the rumen and not in the postruminal gut segments. The principal component analysis indicated that the LAB communities in the silage, rumen fluid, and feces were separately grouped; hence, the survival of silage LAB in the cow rumen and lower gut was deemed difficult. It was concluded that, although the gut LAB community is robust and not easily affected by the silage conditions, several LAB species can inhabit both silage and feces, which suggests the potential of using silage as a vehicle for conveying probiotics.

Effects of Lactobacillus buchneri as a silage inoculant and as a probiotic on feed intake, apparent digestibility and ruminal fermentation and microbiology in wethers fed low‐dry‐matter whole‐crop maize silage

“…Because the potentially probiotic effects of LAB inoculation remain unknown, further studies are encouraged to focus on the ruminal bacterial community of animals fed LAB‐treated silages. The actual scenario in vivo remains unclear; however, the results of the present study combined with those of previous studies (Gollop et al., ; Han, Ogata, Yamamoto, Nagao, & Nishino, ; Mohammed et al., ) indicate that enhanced growth performance might arise from (i) a positive effect of LAB on the nutritional value of silage and (ii) shifts in the ruminal bacterial community, and that these responses might be LAB‐ and crop specific and also dose dependent.…”

Dietary Casein and Soy Protein Isolate Modulate the Effects of Raffinose and Fructooligosaccharides on the Composition and Fermentation of Gut Microbiota in Rats

“…A variable (V3) region of the bacterial 16S rRNA gene was amplified using the universal primers GC357f and 517r and the PCR program previously described (Han and others ). Amplicons were separated via DGGE by using the DCode Universal Mutation Detection System (Bio‐Rad Ltd., Tokyo, Japan).…”

Identification and isolation of Lactobacillus fructivorans from wilted alfalfa silage with and without molasses

“…Silage samples were added to a 209 volume of sterilized phosphate-buffered saline (pH 7Á4), and DNA extraction was performed as described by Han et al (2014). Polymerase chain reaction (PCR) was used to amplify a variable (V3) region of the bacterial 16S rRNA gene by using the forward primer GC357f (5 0 -CGCCCGCCGCGCGC GGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGA GGCAGCAG-3 0 ) and the reverse primer 517r (5 0 -ATTAC CGCGGCTGCTGG-3 0 ).…”