Identification of Mouse and Human Antibody Repertoires by Next-Generation Sequencing

Abstract

The immense adaptability of antigen recognition by antibodies is the basis of the acquired immune system. Despite our understanding of the molecular mechanisms underlying the production of the vast repertoire of antibodies by the acquired immune systems, it has not yet been possible to arrive at a global view of a complete antibody repertoire. In particular, B cell repertoires have been regarded as a black box because of their astronomical number of antibody clones. However, next-generation sequencing technologies are enabling breakthroughs to increase our understanding of the B cell repertoire. In this report, we describe a simple and efficient method to visualize and analyze whole individual mouse and human antibody repertoires. From the immune organs, representatively from spleen in mice and peripheral blood mononuclear cells in humans, total RNA was prepared, reverse transcribed, and amplified using the 5'-RACE method. Using a universal forward primer and antisense primers for the antibody class-specific constant domains, antibody mRNAs were uniformly amplified in proportions reflecting their frequencies in the antibody populations. The amplicons were sequenced by next-generation sequencing (NGS), yielding more than 10 5 antibody sequences per immunological sample. We describe the protocols for antibody sequence analyses including V(D)J-gene-segment annotation, a bird's-eye view of the antibody repertoire, and our computational methods. Video Link The video component of this article can be found at https://www.jove.com/video/58804/ 8. In addition to V-gene usage profile, the observed frequency of VDJ-profile in naive peripheral B cells is highly similar between individuals 8. The analysis of the amino acid sequences of the VDJ-region also showed the occurrence of the same junctional

Sexual dimorphism modulates metabolic and cognitive alterations under HFD nutrition and chronic stress exposure in mice. Correlation between spatial memory impairment and BDNF mRNA expression in hippocampus and spleen

“…In particular, it was found that BDNF mRNA expression could be a biological marker indicating the severity of executive dysfunctions in patients with substance-use disorders (Anders et al, 2020). Similarly, spleen has been used as representative immune organ in mice in the same way as the use of peripheral blood mononuclear cells in humans (Sun et al, 2019). In sense, we found that HFD feeding induces cognitive alterations related to a decrease in BDNF mRNA expression in spleen.…”

Characterizing adjuvants’ effects at the murine immunoglobulin repertoire level

“…For library prep, we developed an adapted 5’ rapid amplification of cDNA ends (5’RACE) approach (Fig 1B) 27, 28, 29, 30, 31, 32, 33 , which is simple, unbiased, and requires only minimal amounts of material 27 . We improved the protocol by incorporating features for high-quality and accurate repertoire sequencing.…”

“…We adopted a 5’ rapid amplification of cDNA ends (5’RACE) approach for library prep (Fig. 1B) 27, 28, 29, 30, 31, 32, 33 . cDNA synthesis was done with two primers, forward template switching oligos (TSO) with unique molecular identifiers (UMI) /5Biosg/-GTCAGATGTGTATAAGAGACAGNNHATTNNHNNATTNNCGATAGrGrGrG-3’ and reverse 5’- GTGTCACGTACAGAGTCATC(T) 30 VN-3’.…”