Identification of the sigB Operon in Staphylococcus epidermidis : Construction and Characterization of a sigB Deletion Mutant

Abstract

The role of the alternative sigma factor B in Staphylococcus epidermidis was investigated by the construction, complementation, and characterization of a sigB deletion mutant. Electrophoretic analyses confirmed a profound influence of B on the expression of exoproteins and cytoplasmic proteins. Detailed investigation revealed reduced lipase and enhanced protease activity in the B mutant. Furthermore, no significant influence of B on heterologous biofilm formation or on the activity of the global regulator agr was detected. Staphylococcus epidermidis ranks among the most important nosocomial pathogens, mainly because of its ability to colonize indwelling medical devices by forming a biofilm (9, 10, 29). In addition, many antibiotics lose their effectiveness against S. epidermidis in the biofilm environment because of the impenetrable slime capsule (6, 28). A further factor contributing to the severe threat of S. epidermidis to public health is the occurrence of multiresistant and vancomycin-resistant strains (24). Virtually nothing is known about the regulation of virulence factors in S. epidermidis. An agr deletion mutant has recently been constructed and characterized by our group (30), but no other global regulator has been studied so far.A region of the chromosome of S. epidermidis Tü3298 comprising four open reading frames with strong sequence similarities to the S. aureus sigB operon was sequenced by direct chromosomal sequencing (GenBank accession number AF359562), starting with primer S1 (CACGAAGATTTAGT TCAAGTTGGTATGGTGG), derived from the S. aureus sequence. The striking similarity in both sequence and overall genetic organization suggested that this region is the sigB operon of S. epidermidis (Fig. 1).In order to analyze its function in S. epidermidis, sigB was replaced by a spectinomycin resistance gene (spc) from Tn554 (19) by homologous recombination (Fig. 1). Since the rsb genes are tightly clustered and rsbW and sigB overlap, we decided not to replace the first bases of sigB, leaving the anti-sigma factor rsbW intact. Fragments of about 870 bp upstream and downstream of sigB were amplified using primer pairs SigEcoRI and SigBamHI (GATTAAAGTGAATTCATGTAGGGTATAGG and CAGGTGATGGATCCCTAGCTGATTTCGAC) for fragment 1 and SigSphI and SigHindIII (GCTGCATGCCAGTA AACGAGTTGTTAAC and GAGGAAAAGCTTAGTCCCT GATTAAAAACATC) for fragment 2. The fragments were cloned into the polylinker region of plasmid pBT2 (2), flanking the spectinomycin resistance gene. The resulting plasmid, pBT⌬sigB, was introduced into S. epidermidis Tü3298 by electroporation (1). Allelic replacement of the wild-type sigB gene by spc was carried out as previously described (2). The correct insertion of the antibiotic resistance marker in the resulting strain, S. epidermidis Tü⌬sigB, was confirmed by Southern blot analysis and chromosomal sequencing.To investigate the influence of B on protein expression, protein samples from stationary phase (16 h) cultures were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The...

RsbU-Dependent Regulation of Staphylococcus epidermidis Biofilm Formation Is Mediated via the Alternative Sigma Factor σ B by Repression of the Negative Regulator Gene icaR

“…In contrast, Kies et al (35) demonstrated that the expression of the icaADBC locus in trans from plasmid pCN27 (31) in a sigB mutant in the icaADBC-negative genetic background of S. epidermidis Tü3298 was able to form large cell clusters. These findings lead to the conclusion that the B -independent biofilm formation of this strain might therefore be explained by a nonfunctional RsbU-mediated regulatory pathway (35). However, the icaR gene, encoding a recently characterized negative regulator of icaADBC transcription (14), is lacking in plasmid pCN27, which could also explain the observed biofilm-positive phenotype in the sigB mutant.…”

The Alternative Sigma Factor σHIs Required for Toxin Gene Expression byBacillus anthracis

“…Similarly, lipase gene expression is differentially regulated by the alternative sigma factor SigB in the closely related species Staphylococcus aureus and Staphylococcus epidermidis (27). While lipase secretion is elevated in an S. aureus sigB-null mutant (30), secretion of processed lipase in an S. epidermidis sigB-null mutant is reduced significantly (28).…”

Alternative Sigma Factors and Their Roles in Bacterial Virulence

“…1A); however, B serves different functions in the two species. Processing of lipase, a virulence factor, is dependent on B in S. epidermidis (102), while in S. aureus, lipase production is higher in a sigB mutant than in the wild-type strain (114). Multiple studies of B and S. epidermidis virulence suggest that B 's effects are mediated primarily through its influence on biofilm formation in this organism (33,106,107).…”