The biosynthetic gene clusters of the staphylococcal lantibiotics epidermin and gallidermin are distinguished by the presence of the unique genes epiH and gdmH, respectively. They encode accessory factors for the ATP-binding cassette transporters that mediate secretion of the antimicrobial peptides. Here, we show that gdmH also contributes to immunity to gallidermin but not to nisin. gdmH alone affected susceptibility to gallidermin only moderately, but it led to a multiplication of the immunity level mediated by the FEG immunity genes when cloned together with the gdmT gene, suggesting a synergistic activity of the H and FEG systems. gdmH-related genes were identified in the genomes of several bacteria, indicating an involvement in further cellular functions.Many gram-positive bacteria produce antimicrobial peptides (bacteriocins) active against other gram-positive strains. The activity of type A lantibiotics is based on pore formation in the cytoplasmic membrane. They contain unusual thioether bridges that arise from the posttranslational modification of cysteine and serine or threonine residues (for reviews, see references 2, 3, 5, and 20). The gene clusters of lantibiotics, such as nisin (produced by Lactococcus lactis), subtilin (produced by Bacillus subtilis), epidermin, and Pep5 (both produced by Staphylococcus epidermidis) comprise very similar sets of genes; the roles of most of them have been elucidated. We have previously characterized the epidermin genes for peptide synthesis (epiA) (21), maturation (epiB, -C, and -D) (9, 10, 16), processing (epiP) (4), and regulation (epiQ) (14) in the heterologous cloning host Staphylococcus carnosus. The genes epiF, -E, and -G encode the subunits of an ATP-binding cassette ABC exporter that confers on the producer immunity to epidermin by expelling the antimicrobial peptides from the cytoplasmic membrane (12, 15).The epidermin transporter gene epiT has been shown to be defective, since it is disrupted by a deletion causing a frameshift. The gdmT gene of the closely related lantibiotic gallidermin from Staphylococcus gallinarum, however, is intact and mediated a considerable increase of epidermin production when cloned in epidermin-producing strains. This effect was dependent on the presence of the adjacent gene, gdmH, indicating that GdmH acts as an accessory factor for the ATPbinding cassette transporter GdmT (18). gdmH encodes a membrane protein without similarity to proteins of known function. Homologous genes are lacking in all lantibiotic gene clusters except those of the epidermin and gallidermin determinants.GdmH contributes to producer immunity. The sensitivities to gallidermin of S. carnosus strains bearing gdmH alone or in combination with other members of the gene clusters (Fig. 1) were analyzed. Since only part of the gdmFEG operon was available, the epiFEG operon was used. The Epi and Gdm proteins have a high degree of identity, and several genes of the two gene clusters have been shown to be interchangeable (11,18). In order to combine functional FEG...

The role of the alternative sigma factor B in Staphylococcus epidermidis was investigated by the construction, complementation, and characterization of a sigB deletion mutant. Electrophoretic analyses confirmed a profound influence of B on the expression of exoproteins and cytoplasmic proteins. Detailed investigation revealed reduced lipase and enhanced protease activity in the B mutant. Furthermore, no significant influence of B on heterologous biofilm formation or on the activity of the global regulator agr was detected. Staphylococcus epidermidis ranks among the most important nosocomial pathogens, mainly because of its ability to colonize indwelling medical devices by forming a biofilm (9, 10, 29). In addition, many antibiotics lose their effectiveness against S. epidermidis in the biofilm environment because of the impenetrable slime capsule (6, 28). A further factor contributing to the severe threat of S. epidermidis to public health is the occurrence of multiresistant and vancomycin-resistant strains (24). Virtually nothing is known about the regulation of virulence factors in S. epidermidis. An agr deletion mutant has recently been constructed and characterized by our group (30), but no other global regulator has been studied so far.A region of the chromosome of S. epidermidis Tü3298 comprising four open reading frames with strong sequence similarities to the S. aureus sigB operon was sequenced by direct chromosomal sequencing (GenBank accession number AF359562), starting with primer S1 (CACGAAGATTTAGT TCAAGTTGGTATGGTGG), derived from the S. aureus sequence. The striking similarity in both sequence and overall genetic organization suggested that this region is the sigB operon of S. epidermidis (Fig. 1).In order to analyze its function in S. epidermidis, sigB was replaced by a spectinomycin resistance gene (spc) from Tn554 (19) by homologous recombination (Fig. 1). Since the rsb genes are tightly clustered and rsbW and sigB overlap, we decided not to replace the first bases of sigB, leaving the anti-sigma factor rsbW intact. Fragments of about 870 bp upstream and downstream of sigB were amplified using primer pairs SigEcoRI and SigBamHI (GATTAAAGTGAATTCATGTAGGGTATAGG and CAGGTGATGGATCCCTAGCTGATTTCGAC) for fragment 1 and SigSphI and SigHindIII (GCTGCATGCCAGTA AACGAGTTGTTAAC and GAGGAAAAGCTTAGTCCCT GATTAAAAACATC) for fragment 2. The fragments were cloned into the polylinker region of plasmid pBT2 (2), flanking the spectinomycin resistance gene. The resulting plasmid, pBT⌬sigB, was introduced into S. epidermidis Tü3298 by electroporation (1). Allelic replacement of the wild-type sigB gene by spc was carried out as previously described (2). The correct insertion of the antibiotic resistance marker in the resulting strain, S. epidermidis Tü⌬sigB, was confirmed by Southern blot analysis and chromosomal sequencing.To investigate the influence of B on protein expression, protein samples from stationary phase (16 h) cultures were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The...

No abstract