Identification of the Klebsiella pneumoniae glnB gene: Nucleotide sequence of wild-type and mutant alleles

Abstract

The glnB gene of Klebsiella pneumoniae, which encodes the nitrogen regulation protein PII, has been cloned and sequenced. The gene encodes a 12429 dalton polypeptide and is highly homologous to the Escherichia coli glnB gene. The sequences of a glnB mutation which causes glutamine auxotrophy and of a Tn5 induced Gln+ suppressor of this mutation were also determined. The glutamine auxotrophy was deduced to be the result of a modification of the uridylylation site of PII, and the suppression was shown to be caused by Tn5 insertion in glnB. The 3' end of an open reading frame of unknown function was identified upstream of glnB and may be part of an operon containing glnB. Potential homologues of glnB encoding polypeptides extremely similar in sequence to PII were identified upstream of published sequences of the glutamine synthetase structural gene (glnA) in Rhizobium leguminosarum, Bradyrhizobium japonicum and Azospirillum brasilense.

Nitrogen Assimilation in Escherichia coli: Putting Molecular Data into a Systems Perspective

“…The P II protein is encoded by the glnB gene. The gene product (GlnB) consists of 112 amino acids (143)(144)(145)(146), and here we refer to P II as GlnB. Tyrosine 51 of GlnB is modified by the uridylylation reaction, as has been shown by biochemical analysis and site-directed mutagenesis (145,147,148).…”

The role of the T‐loop of the signal transducing protein PII from Escherichia coli

“…The reduction of uridylylation efficiency of Y46F supports this notion and it is likely that mutations of other amino acids in the loop may similarly affect the rate of uridylylation. Indeed, Holtel and Merrick [28] have obtained the nucleotide sequence of a glutamine auxotroph of K. pneumoniae glnB502 where the only change in the glnB ORF resuits in E50K mutation. In vitro uridylylation has not been attempted on this mutant but the glutamine auxotrophy phenotype may be due to lack of PII-UMP formation.…”

Transcription of the glnB and glnA genes in the photosynthetic bacterium Rhodospirillum rubrum

“…The nucleotide sequence of the ORF shows up to 83% identity toglnB genes from other organisms (Son & Rhee, 1987;Holtel & Merrick, 1988;Martin e t al., 1989;Chiuarazzi & Iaccarino, 1990 ; AACGACTGTCCGTCCCAGGGAAAAAGAAGTATTTZTPCAGCCAC'T%GG~AKAWW -140 -120 -100 …”

“…Primer extension identified a site within Klebsiella pneumoniae (Holtel & Merrick, 1988), Rhodobacter capsulatus (Kranz et a/., 1990), Rhodobacter sphaeroides (Zinchenko et a/., 1994), Rhizobium legurninosarum (Chiuarazzi & laccarino, 1990), Bradyrhizobium japonicum (Martin et a/., 1989) and Synechococcus sp. PCC7942 (Tsinoremas e t a/., 1991).…”