Identification of Two Novel Coccidian Species Shed by California Sea Lions (Zalophus californianus)

Carlson-Bremer, Daphne; Johnson, Christine K.; Miller, Ruth; Gulland, Frances M. D.; Conrad, Patricia A.; Wasmuth, James D.; Colegrove, Kathleen M.; Grigg, Michael E.

doi:10.1645/ge-2752.1

Cited by 13 publications

(19 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Genomic DNA was amplified using primers that amplify a 350 nucleotide fragment within a conserved 3′ terminal portion of the 18S rRNA gene to delineate the phyla of the organisms involved (Carlson‐Bremer et al. ) as well as primers that amplify across a 1,669 nucleotide length of the 18S rRNA gene as follows: Fext‐GGTTGATCCTGCCAGTAGTCA; Fint‐TAAAGATTAAGCCATGCATGTC; Rext‐CCTCTAAGTGTTAAGGTTCAC; and Rint‐TACAAAGGGCAGGGACGTAA. The following primers that amplify the rpoB gene, a multicopy polymorphic marker in the organellar apicoplast genome, were used to further discriminate between taxa and permit multilocus molecular genotyping (Wendte et al.…”

Section: Methodsmentioning

confidence: 99%

Sarcocystis caninum and Sarcocystis svanai n. spp. (Apicomplexa: Sarcocystidae) Associated with Severe Myositis and Hepatitis in the Domestic Dog (Canis familiaris)

Dubey

Sykes

Shelton

et al. 2014

J Eukaryotic Microbiology

Self Cite

View full text Add to dashboard Cite

There are several reports of Sarcocystis sarcocysts in muscles of dogs but these species have not been named. Additionally, there are 2 reports of Sarcocystis neurona in dogs. Here, we propose 2 new names, Sarcocystis caninum, and Sarcocystis svanai for sarcocysts associated with clinical muscular sarcocystosis in 4 domestic dogs (Canis familiaris), 1 each from Montana and Colorado in the USA, and 2 from British Columbia, Canada. Only the sarcocyst stage was identified. Most of the sarcocysts identified were S. caninum. Sarcocysts were studied using light microscopy, transmission electron microscopy, and PCR. Based on collective results 2 new species, Sarcocystis caninum and Sarcocystis svanai were designated. Sarcocystis caninum and Sarcocystis svanai were structurally distinct. Sarcocystis caninum sarcocysts were up to 1.2 mm long and up to 75 μm wide. By light microscopy, the sarcocyst wall was relatively thin and smooth. By transmission electron microscopy (TEM), the sarcocyst wall “type 9”, 1–2 μm thick, and contained villar protrusions that lacked microtubules. Bradyzoites in sections were 7–9 μm long. Sarcocysts of S. svanai were few and were identified by TEM. Sarcocystis svanai sarcocysts were “type 1”, thin walled (< 0.5 μm), and the wall lacked villar protrusions but had tiny blebs that did not invaginate. DNA was extracted either from infected frozen muscle biopsies or formalin-fixed paraffin-embedded sections. Dogs were either singly infected with S. caninum or multiply co-infected with S. caninum and S. svanai (the result of a mixed infection) based on multi-locus DNA sequencing and morphology. BLASTn analysis established that the sarcocysts identified in these dogs were similar to, but not identical to S. canis or S. arctosi, parasites found to infect polar bears (Ursus maritimus) or brown bears (Ursus arctosi), respectively. However, the S. caninum sequence showed 100% identify over the 18S rRNA region sequenced to that of S. arctica, a parasite known to infect Arctic foxes (Vulpes lagopus).

show abstract

Section: Methodsmentioning

confidence: 99%

Sarcocystis caninum and Sarcocystis svanai n. spp. (Apicomplexa: Sarcocystidae) Associated with Severe Myositis and Hepatitis in the Domestic Dog (Canis familiaris)

Dubey

Sykes

Shelton

et al. 2014

J Eukaryotic Microbiology

Self Cite

View full text Add to dashboard Cite

show abstract

“…California sea lions Zalophus californianus, for example, are definitive and intermediate hosts to at least 4 coccidian parasites that cause little to no disease (Colegrove et al 2011, Carlson-Bremer et al 2012). Exposure to protozoa has been serologically determined in many pinniped taxa (Measures et al 2004, Littnan et al 2007, ABSTRACT: Protozoal infections have been widely documented in marine mammals and may cause morbidity and mortality at levels that result in population level effects.…”

Section: Introductionmentioning

confidence: 99%

Protozoal-related mortalities in endangered Hawaiian monk seals Neomonachus schauinslandi

Barbieri

Kashinsky

Rotstein³

et al. 2016

Dis. Aquat. Org.

View full text Add to dashboard Cite

“…and Giardia sp.) have also been reported in CSLs ( Carlson-Bremer et al, 2012 , 2015 ; Adell et al, 2014 ; Girard et al, 2015 ).…”

Section: Introductionmentioning

confidence: 61%

Metazoan parasites of California sea lions (Zalophus californianus): A new data and review

Kuzmina

Spraker

Kudlai

et al. 2018

International Journal for Parasitology: Parasites and Wildlife

View full text Add to dashboard Cite

The population of California sea lion Zalophus californianus (CSL) has steadily increased during the last several decades. Despite extensive research addressing CSL biology and ecology performed during the last decades, there has been a minimal number of published papers documenting their parasite fauna. Our objective was to analyze the actual list of the metazoan parasites reported from CSLs and add new data on the age-related differences in the prevalence and biodiversity of the parasite community. There have been 33 species recorded but this study considers only 24 of them valid. Among them, 11 species are specific parasites of CSLs and 13 species are not specific. Additional species represent accidental infections or misidentifications. In total, 6653 helminths and 847 mites were collected and identified from 34 CSLs for this study. Six species of nematodes, Anisakis simplex sensu lato s. l. (prevalence 41%; intensity 7.6), Contracaecum ogmorhini s. l. (38%; 269.6), Pseudoterranova decipiens s. l. (29%; 33), P. azarazi (9%; 2.7), Acanthocheilonema odendhali (15%; 3.5) and Parafilaroides decorus were found. Two species of cestodes, Diphyllobothrium sp. (38%; 8.5) and Anophryocephalus sp. (15%; 14.6) represent novel undescribed species. Two species of trematodes, Apophallus zalophi (18%; 19.7) and Zalophotrema hepaticum (12%; 39.2), and five species of acanthocephalans, Corynosoma obtuscens (68%; 100.8), C. strumosum (53%; 4.6), Andracantha phalacrocoracis (3%; 1), Andracantha sp. (9%; 4.3) and Profilicollis altmani (6%; 8.5) were found. Mites Orthohalarchne attenuata (prevalence 85%) were found in the nasal cavity, while O. diminuata (21%) parasitized in the trachea and bronchi. The highest levels of infection with nematodes and trematodes were found in adult CSLs (3–16 years old), whereas the highest level of infection with acanthocephalans was found in young CSLs (pups and yearlings).

show abstract

Identification of Two Novel Coccidian Species Shed by California Sea Lions (Zalophus californianus)

Cited by 13 publications

References 29 publications

Sarcocystis caninum and Sarcocystis svanai n. spp. (Apicomplexa: Sarcocystidae) Associated with Severe Myositis and Hepatitis in the Domestic Dog (Canis familiaris)

Sarcocystis caninum and Sarcocystis svanai n. spp. (Apicomplexa: Sarcocystidae) Associated with Severe Myositis and Hepatitis in the Domestic Dog (Canis familiaris)

Protozoal-related mortalities in endangered Hawaiian monk seals Neomonachus schauinslandi

Metazoan parasites of California sea lions (Zalophus californianus): A new data and review

Contact Info

Product

Resources

About