Identification of Tyrosinase-related Protein 2 as a Tumor Rejection Antigen for the B16 Melanoma

Abstract

Recently, major advances have been made in the identification of antigens from human melanoma which are recognized by T cells. In spite of this, little is known about the optimal ways to use these antigens to treat patients with cancer. Progress in this area is likely to require accurate preclinical animal models, but the availability of such models has lagged behind developments in human tumor immunology. Whereas many of the identified human melanoma antigens are normal tissue differentiation proteins, analogous murine tumor antigens have not yet been identified. In this paper we identify a normal tissue differentiation antigen, tyrosinaserelated protein 2 (TRP-2), expressed by the murine B16 melanoma which was found by screening a cDNA library from B16 with tumor-reactive cytotoxic T lymphocytes (CTL). A peptide conforming to the predicted MHC class I H2-Kb binding motif, TRP-2181-188, was identified as the major reactive epitope within TRP-2 recognized by these anti-B16 CTLs. By site-directed mutagenesis, it was shown that alteration of this epitope eliminated recognition of TRP-2. It was further demonstrated that a CTL line raised from splenocytes by repeated stimulation in vitro with this peptide could recognize B16 tumor and was therapeutic against 3-d-old established pulmonary metastases. The use of TRP-2 in a preclinical model of tumor immunotherapy may be helpful in suggesting optimal vaccination strategies for cancer therapy in patients.

‘Survival gene’ Bcl-xl potentiates DNA-raised antitumor immunity

“…The truncated mouse TRP2 (the transmembrane domain and the rest of C-terminal sequences and stop codon were deleted) 27 was cloned into pcDNA 3.1(+) expression vector (Invitrogen) at the unique sites of NheI and BamHI (pcDNA3.1(+)-TRP2-ns) using standard PCR clone strategy and primers: 5 0 CTAGCTAGCATGGGCC TTGTGGGATGGGGGCTT (P1) and 5 0 CGGGATCCTGA GAGAGTTGTGGACCAAACTGG. The human hsp70 53 was cloned into pcDNA3.1(+)-TRP2-ns vector at the unique sites of BamHI and NotI (TRP2hsp70) using standard PCR clone strategy and primers: 5 0 CGGGATC CATGGCCAAAGCCGCGGCAGTC and 5 0 ATAAGAAT GCGGCCGCCTAATCTACCTCCTCAATGGT (P2).…”

“…Naturally expressed tyrosinase-related protein 2 (TRP2) is a tissue differentiation antigen expressed by normal melanocytes, malignant melanocytes and glioblastoma. 27,28 Murine B16 melanoma cells are weakly immunogenic and sublines exist with varying tumorigenic and metastatic capabilities, which are similar to human cancers. 29 Thus, TRP2 is an excellent self-antigen model to validate new tumor vaccine strategies against TRP2-expressing tumors such as B16 melanoma.…”

Dendritic cells transduced with gp100 gene by RGD fiber-mutant adenovirus vectors are highly efficacious in generating anti-B16BL6 melanoma immunity in mice

“…15,16,18 In recent years, the cloning of various MAAs interacting with the melanocyte differentiation and melanogenesis pathways has opened new possibilities for the development of active immunotherapy designed to cause the rejection of malignant melanoma. [19][20][21][22][23] gp100, an MAA, is consistently expressed in both murine and human melanomas, 27,40 and has been shown to be highly immunogenic and an important target for active-specific immunotherapy in humans. 41 However, mice injected with Ad 26 or recombinant vaccinia virus 27 encoding murine gp100, which was cloned from a B16 cDNA library, failed to produce any detectable T-cell responses or protective immunity against murine B16 melanoma.…”

“…These include gp100, MART-1/Melan-A, tyrosinase, and tyrosinase-related protein. [19][20][21][22][23] Among these defined melanoma-associated antigens (MAAs), which are nonmutated self-differentiation antigens associated with melanin synthesis in normal melanocytes, gp100 appears to be a promising target antigen. Several human MHC class I-restricted peptides from gp100 have been identified, and vaccination strategies using synthetic gp100-derived peptides in conjunction with chemical adjuvant or autologous DCs have been evaluated in early phase I/II clinical trials.…”

CD27 stimulation unveils the efficacy of linked class I/II peptide vaccines in poorly immunogenic tumors by orchestrating a coordinated CD4/CD8 T cell response

“…To test this hypothesis, we evaluated the adjuvant activity of αhCD27 when combined with a known CD4 + T cell universal class II helper epitope, tetanus toxin (TT) P30 (TT(948–968)). 27 We developed a peptide vaccine consisting of Ova(I) covalently linked with the P30 epitope (Ova(I)-P30) (Table 1) and administered it with or without adjuvant αhCD27. A linker sequence consisting of a furin cleavage site 28 was included between the Ova(I) and P30 epitopes to ensure that this synthetic long peptide would be processed into two distinct epitopes.…”