Identification of Zucchini yellow mosaic potyvirus by RT-PCR and analysis of sequence variability

Thomson, Karen; Dietzgen, Ralf G.; Gibbs, Adrian; Tang, Yuxin; Liesack, Werner; Teakle, D. S.; Stackebrandt, Erko

doi:10.1016/0166-0934(95)00047-x

Cited by 43 publications

(21 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Sequence data for the 3 0 terminal part of the genome, including the coat protein coding region, have been obtained for strains from Connecticut (Grumet & Fang, 1990), Florida (Quemada et al, 1990), Israel (Gal-On et al, 1990), and Singapore (Lee et al, 1993). The sequence of the N-terminal part of the coat protein coding region was established for three strains from Australia (Thomson et al, 1995) and 15 strains from Martinique (Desbiez et al, 1996). Sequences of the HC gene are also available for the Israel strain, and for French strains (Granier et al, 1993, Huet et al, 1994.…”

Section: Molecular Datamentioning

confidence: 99%

See 1 more Smart Citation

Zucchini yellow mosaic virus

Desbiez¹,

Lecoq²

1997

Plant Pathology

224

172

View full text Add to dashboard Cite

Zucchini yellow mosaic potyvirus (ZYMV), first isolated in Italy in 1973, described in 1981, and then identified in all continents within a decade, is one of the most economically important viruses of cucurbit crops. It is efficiently aphid-transmitted in a nonpersistent manner and it is also seed-borne in zucchini squash, which could have contributed to its rapid spread worldwide. Biological variability has been observed among ZYMV isolates, concerning host range, symptomatology and aphid transmissibility. More recent studies also revealed a serological and molecular variability. The survival of ZYMV in areas where cucurbits are not grown throughout the year remains to be elucidated, because very few natural over-wintering hosts have been identified so far. Partial control of ZYMV can be achieved by limiting transmission of the virus to the crops by aphids, using adapted cultural practices. Cross-protection with a mild strain has been shown to be effective against most ZYMV isolates. Resistance genes found in cucurbit germplasms are currently being introduced into cultivars with good agronomical characteristics. Pathogen-derived resistance strategies using the expression of ZYMV genes in transgenic plants have also been developed and appear promising. Nevertheless, the high biological variability of ZYMV justifies a careful evaluation of the deployment of genetic control strategies in order to increase their durability.

show abstract

Section: Molecular Datamentioning

confidence: 99%

“…In the case of ZYMV, reverse-transcription (RT)-PCR was used successfully to amplify viral fragments of the 3' terminal part of the genome, from extracted total plant RNA (Thomson et al, 1995). The amplified fragment is then directly available for further molecular analysis.…”

Section: Molecular Techniquesmentioning

confidence: 99%

Zucchini yellow mosaic virus

Desbiez¹,

Lecoq²

1997

Plant Pathology

224

172

View full text Add to dashboard Cite

show abstract

“…RT-PCR was carried out using the primers ZY2 [5'-GCTCCATACATAGCTGAGACAGC-3'], which was derived from the NIb gene, and ZY3 [5'-TAGGCTT-GCAAACGGAGTCTAATC-3'], which anneals to the 3' untranslated region (Thomson, 1995); to amplify a fragment of 1186 bp containing part of the NIb gene, the complete coat protein gene and most of the 3' untranslated region.…”

Section: Rna Isolation and Rt-pcrmentioning

confidence: 99%

Biological and molecular characterization of Brazilian isolates of Zucchini yellow mosaic virus

Spadotti

Wassano

Rezende

et al. 2015

Sci. agric. (Piracicaba, Braz.)

View full text Add to dashboard Cite

Zucchini yellow mosaic virus (ZYMV) causes substantial economic losses in cucurbit crops. Although ZYMV has been present in Brazil for more than 20 years, there is little information about the biological and molecular characteristics of the isolates found in the country. This study aimed to characterize the experimental hosts, pathotypes and genetic diversity of a collection of eleven Brazilian ZYMV isolates within the coat protein gene. For biological analysis, plant species from Amaranthaceae, Chenopodiaceae, Cucurbitaceae, Fabaceae, Solanaceae, and Pedaliaceae were mechanically inoculated and pathotypes were identified based on the reaction of a resistant Cucumis melo, accession PI414723. All of the cucurbit species/varieties and Sesamum indicum were systemically infected with all isolates. The nucleotide sequence variability of the coat protein gene ranged from 82 % to 99 % compared to the corresponding sequences of ZYMV isolates from different geographical locations. No recombination event was detected in the coat protein gene of the isolates.

show abstract

“…PCR amplification was performed using recombinant Taq DNA polymerase (Fermentas, USA) and 30 ng of cDNA. Thermocycling conditions were same as reported by Thomson et al [3]. RT-PCR resulted in amplification of *1.1 Kbp in both of the symptomatic samples of Gherkin and Pumpkin (Fig.…”

mentioning

confidence: 82%

“…Total RNA from the virus infected and healthy pumpkin and gherkin leaves was isolated using Trizol Reagent (Sigma, USA) and (ZY2 gctccatacatagctgagacagc and ZY3 taggctttttgcaaacggagtctaatc) the primers reported by Thomson et al [3] were used in RT-PCR. Reverse transcription was conducted using oligo-dT primer and revert aid reverse transcriptase (Fermentas, USA) using 1 lg of total RNA as template.…”

mentioning

confidence: 99%