Immunoreceptor tyrosine-based inhibitory motif–dependent functions of an MHC class I-specific NK cell receptor

Abstract

Natural killer (NK) cells express MHC class I (MHC-I)-specific receptors, such as Ly49A, that inhibit killing of cells expressing self–MHC-I. Self–MHC-I also “licenses” NK cells to become responsive to activating stimuli and regulates the surface level of NK-cell inhibitory receptors. However, the mechanisms of action resulting from these interactions of the Ly49s with their MHC-I ligands, particularly in vivo, have been controversial. Definitive studies could be derived from mice with targeted mutations in inhibitory Ly49s, but there are inherent challenges in specifically altering a single gene within a multigene family. Herein, we generated a knock-in mouse with a targeted mutation in the immunoreceptor tyrosine-based inhibitory motif (ITIM) of Ly49A that abolished the inhibitory function of Ly49A in cytotoxicity assays. This mutant Ly49A caused a licensing defect in NK cells, but the surface expression of Ly49A was unaltered. Moreover, NK cells that expressed this mutant Ly49A exhibited an altered inhibitory receptor repertoire. These results demonstrate that Ly49A ITIM signaling is critical for NK-cell effector inhibition, licensing, and receptor repertoire development.

Cytokine Networks between Innate Lymphoid Cells and Myeloid Cells

“…Astonishingly, “memory-like” NK cells expressing the receptor Ly49H have been found to sustain their activation state and exhibit accelerated responses upon reengagement of this receptor ( 119 ). With recent observations describing the expression of PD1 on ILC3 subsets and additional inhibitory receptors being expressed by NK cells and ILC2 subsets (e.g., Ly49A, KLRG1, or CTLA4), a critical role of check point inhibitors and their ligands on myeloid cells requires future investigations ( 120 – 122 ). Noteworthy, two recent reports identified regulatory functions in ILC subsets suggest ILC-mediated negative regulations, particularly during inflammation ( 107 , 123 ).…”

Novel natural killer cell-mediated cancer immunotherapeutic activity of anisomycin against hepatocellular carcinoma cells

“…4e,f ). MHC-I molecules are known for their inhibitory activity against NK cell killing on tumour cells 23 . Thus, anisomycin-mediated downregulation of MHC-I may increase the susceptibility of HCC cells to NK cell killing.…”

Major histocompatibility complex class I-restricted protection against murine cytomegalovirus requires missing-self recognition by the natural killer cell inhibitory Ly49 receptors

“…have been previously described [31]. KLRA7 em1(IMPC)J (Ly49G KO) mice on the C57BL/6NJ background were 309 purchased from the Jackson Laboratory (027444); this allele was generated at the Jackson Laboratory by 310 CRISPR-Cas9 injection of Cas9 RNA and 3 gRNAs: TCTTGTACTTGTGCATAACC, CAGTCCTCACTAGTTTCTGC 311 and GACATGGACTGACCAAATT resulting in a 241 bp deletion beginning in 5-prime upstream sequence 312 and ending within exon 1.…”

“…We next tested whether loss of inhibitory Ly49s would affect missing-self recognition in vivo as 185 suggested by in vitro studies [5,31] and anti-Ly49 antibody experiments in vivo [32]. Upon injection, 186 labelled KODO (MHC-I-deficient) splenocytes were effectively cleared in D8-KODO mice that were either 187 WT, or lacked only Ly49A or only Ly49G (Fig 4C, S4), in an NK cell-dependent manner as shown by NK 188 cell depletion (Fig S4A, B) We recently generated KI mice carrying Ly49A with a non-functional ITIM (termed Ly49AYF), 195 demonstrating that effector inhibition and licensing are both mediated by the Ly49A ITIM [31]. Ly49AYF 196 D8-KODO mice were resistant to Δm157-MCMV (Fig 4D) similar to D8-KODO mice but, in contrast to D8-197 KODO mice (Fig 3A, B), Ly49G depletion led to significantly elevated viral titers, similar to anti-NK1.1 198 depletion (Fig 4D).…”