Importance of CpG Dinucleotides in Activation of Natural IFN‐α‐Producing Cells by a Lupus‐Related Oligodeoxynucleotide

Abstract

The oligodeoxyribonucleotide (ODN) 5'‐TTTTCAATTCGAAGATGAAT‐3' (ODN H), identified in systemic lupus erythematosus (SLE) serum, induced the production of interferon (IFN)‐α in human peripheral blood mononuclear cells (PBMC) when combined with lipofectin. Flow cytometric analysis with staining for surface antigens and intracellular IFN‐α, showed that the IFN‐α‐producing cells (IPC) were the natural IPC, also termed type 2 dendritic cell precursors (pDC2) or plasmacytoid monocytes. The importance of unmethylated CpG dinucleotides for the interferogenic activity of ODN was studied. Methylation of CpG impaired the activity of single‐stranded (ss) ODN H, but increased that of the complementary ssODN I. Furthermore, CpG‐methylated double‐stranded (ds) ODN Hmet‐Imet lost, but hemimethylated dsODN H‐Imet retained interferogenic activity. Inversion of the CpG to GpC had no effect on the interferogenic activity of ssODN H, increased that of ssODN I, however abolished the activity of dsODN H‐I. Alteration of the CpG in ODN H to ApG and in the ODN I to CpT destroyed their activity. The induction of IFN‐α is therefore sequence‐specific, but unmethylated CpGs are not always required, especially not in ssODNs. Interferogenic DNA sequences could therefore be more frequent in eukaryotic genomes than previously thought and their capacity to activate natural IPC may have implications for immune responses to microbial antigens and nuclear autoantigens.

Induction of interferon‐α production in plasmacytoid dendritic cells by immune complexes containing nucleic acid released by necrotic or late apoptotic cells and lupus IgG

“…A similar reasoning can also be applied to the IFN␣-inducing DNA because autoantibodies to DNA and associated proteins, e.g., nucleosomes and histones, occur in SLE. It is well established that DNA can induce IFN␣ production, and the content of certain unmethylated CpG motifs is usually considered essential, at least in dsDNA (57,58). Furthermore, only the unmethylated form of the plasmid DNA can be used for mimicking SLE IIF in combination with dsDNA antibodies from SLE patients (24).…”

TLR7 Ligands Induce Higher IFN-α Production in Females

“…These complexes induce systemic injury by inflammation of multiple organs (skin, joints, CNS, and various blood elements). SLE patients show elevated IFN-␣ levels in circulation (20 -24), and the sera of SLE patients trigger IFN-␣ production by pDCs (25)(26)(27)(28)(29). Interestingly, pDC numbers in blood of SLE patients are decreased (6) because pDCs are actively recruited to inflamed tissues, lupus skin lesions, and lymphoid organs (30,31).…”

A compass that points to lupus: genetic studies on type I interferon pathway

“…[18][19][20] Such endogenous immunostimulatory chromatin can drive autoantibody production and lead to generation of chromatin-containing ICs. Ronnblom et al [21][22][23][24][25][26] have investigated the capacity of ICs in SLE sera to trigger IFNa production by plasmacytoid dendritic cells (pDCs), which is the primary source of type I IFNs. They provided evidence that autoantibodies associated with apoptotic DNA and RNA, particularly single-stranded CpG sequences in genomic DNA, can provide a stimulus that results in IFNa secretion.…”