The objective was to investigate the relation between serum levels of interferon-alpha (IFN-alpha), the activity of an endogenous IFN-alpha inducing factor (SLE-IIF), clinical and immunological disease activity as well as serum levels of antiretroviral antibodies in SLE. Serum levels of IFN-alpha were measured in serial sera from 30 patients sampled at different stages of disease activity (SLEDAI score). The SLE-IIF activity was measured by its ability to induce IFN-alpha production in cultures of normal peripheral blood mononuclear cells. Both serum IFN-alpha and SLE-IIF increased markedly at flare in serially followed patients. The SLEDAI score, levels of anti-dsDNA antibodies and IL-10 correlated positively, and complement components Clq, C3 and leukocytes correlated inversely with serum concentrations of IFN-alpha. The extent of multiple organ involvement correlated with serum IFN-alpha. No relation between concentrations of retroviral peptide binding antibodies and IFN-alpha or SLE-IIF activity was found. The close relationship between disease activity in SLE patients and IFN-alpha serum levels suggests that activation of the type 1 IFN system might be of importance in the disease process.

Patients with active SLE often have an ongoing production of IFN-alpha. We therefore searched for an endogenous IFN-alpha-inducing factor (IIF) in SLE patients and found that their sera frequently induced production of IFN-alpha in cultures of peripheral blood mononuclear cells (PBMC) from healthy blood donors, especially when the PBMC were costimulated with the cytokines IFN-alpha2b and granulocyte-macrophage colony-stimulating factor (GM-CSF). The phenotype of the IFN-alpha-producing cells (IPC) as determined by flow cytometry corresponded to that of the natural IPC, resembling immature dendritic cells. The IIF activity in SLE sera was sometimes as high as that of a virus and was present especially in patients with active disease and with measurable IFN-alpha levels in serum. The IIF had an apparent molecular weight of 300-1000 kD and appeared to consist of both immunoglobulin and DNA, possibly being immune complexes. This endogenous IFN-alpha inducer may be of pathogenic significance, since a reported occasional adverse effect of IFN-alpha therapy in patients with non-autoimmune disorders is development of anti-dsDNA antibodies and SLE.

No abstract

No abstract

The oligodeoxyribonucleotide (ODN) 5'‐TTTTCAATTCGAAGATGAAT‐3' (ODN H), identified in systemic lupus erythematosus (SLE) serum, induced the production of interferon (IFN)‐α in human peripheral blood mononuclear cells (PBMC) when combined with lipofectin. Flow cytometric analysis with staining for surface antigens and intracellular IFN‐α, showed that the IFN‐α‐producing cells (IPC) were the natural IPC, also termed type 2 dendritic cell precursors (pDC2) or plasmacytoid monocytes. The importance of unmethylated CpG dinucleotides for the interferogenic activity of ODN was studied. Methylation of CpG impaired the activity of single‐stranded (ss) ODN H, but increased that of the complementary ssODN I. Furthermore, CpG‐methylated double‐stranded (ds) ODN Hmet‐Imet lost, but hemimethylated dsODN H‐Imet retained interferogenic activity. Inversion of the CpG to GpC had no effect on the interferogenic activity of ssODN H, increased that of ssODN I, however abolished the activity of dsODN H‐I. Alteration of the CpG in ODN H to ApG and in the ODN I to CpT destroyed their activity. The induction of IFN‐α is therefore sequence‐specific, but unmethylated CpGs are not always required, especially not in ssODNs. Interferogenic DNA sequences could therefore be more frequent in eukaryotic genomes than previously thought and their capacity to activate natural IPC may have implications for immune responses to microbial antigens and nuclear autoantigens.