Important roles of glycinebetaine in stabilizing the structure and function of the photosystem II complex under abiotic stresses

Huang, Shan; Zuo, Tao; Ni, Wuzhong

doi:10.1007/s00425-019-03330-z

Cited by 55 publications

(43 citation statements)

References 119 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In addition, it facilitates osmotic adjustment by reducing the internal osmotic potential that contributes to water stress tolerance in plant cells. It also stabilizes the PSII and RuBisCO complexes during photosynthesis under stress conditions (Holmström et al 2000;Huang et al 2020). These are some of the positive effects of the application of exogenous betaine glycine in plants that grow under the pressure of salinity or drought stress.…”

Section: Discussionmentioning

confidence: 99%

“…Previous studies carried out by Sakamoto and Murata (2000) and Saxena et al (2019) indicated that osmoprotectant substances, such as glycine betaine, play an essential role in cell stabilization by balancing the structure of the protein quaternary and membrane structure against the adverse effects of salinity. Besides, it facilitates osmotic adjustment by lowering the internal osmotic potential, which contributes to the ability to tolerate water pressure, stabilizing the PSII and RuBisCO complexes in the process of photosynthesis under seizure conditions (Holmström et al 2000;Wang et al 2019;Huang et al 2020). The positive effects and exogenous application of glycine in plants grown under salinity stress conditions have been shown to protect plant cells (Demiral and Türkan 2004;Saxena et al 2019).…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Identification of Drought Tolerant and Molecular Analysis of DREB2A and BADH2 Genes and Yield Potensial of Lines from Single Crossing Bengkulu Local Rice Varieties

et al. 2021

View full text Add to dashboard Cite

Screening in the seedling stage of 39 progeny of F6 lines to drought stress was carried out in the greenhouse. Drought tolerant and sensitive varieties of IR 20 and Salumpikit, respectively, were used as control plants. The methods for traits identification of leaf curled, dried, and recovery ability after exposure to severe drought for two weeks was following the Standard Evaluation System (SES) developed by IRRI. Molecular analysis to detect the presence of the DREB2A gene was carried out by PCR amplification of genomic DNA using forward- and reverse- oligonucleotide primers of CCTCATTGGGTCAGGAAGAA and GGATCTCAGCCACCCACTTA, respectively, while for BADH2 gene using forward- and reverse- oligonucleotide primers of GGCCAAGTACCTCAAGGCGA and TGTCCCCAGCTGCTTCATCC, respectively. Molecular markers of DREB2A and BADH2 genes were also identified in 39 tested lines with approximately 250 and 2300 bp length, respectively. This study concluded that the progeny of F6 lines generating from the crossing of local varieties of IR7858 and IR148 is the potential to become a drought-tolerant variety of upland rice. Line numbers BKL2 B-2-264-6 and BKL4 B-1-268-10 have a potential yield of more than 12 tonnes/ha. These line has the potential to be developed on rainfed lowland rice or dry land because it has drought resistance.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Identification of Drought Tolerant and Molecular Analysis of DREB2A and BADH2 Genes and Yield Potensial of Lines from Single Crossing Bengkulu Local Rice Varieties

et al. 2021

View full text Add to dashboard Cite

show abstract

“…GB (N,N ,N -trimethylglycine) is an amphoteric quaternary ammonium compatible osmolyte that confers tolerance under environmental stress [96,97]. Its main beneficial effects are through osmotic adjustment and stabilisation of the photosystem II complex, amongst others [96,98]. Not all plants are able to accumulate GB under abiotic stress, although crops and cultivars that produce higher amounts of GB are usually more tolerant to abiotic stress [97].…”

Section: Glycine Betaine (Gb)mentioning

confidence: 99%

Abiotic Stress in Crop Species: Improving Tolerance by Applying Plant Metabolites

Godoy

Olivos-Hernández

Stange

et al. 2021

Plants

172

View full text Add to dashboard Cite

Reductions in crop yields brought about by abiotic stress are expected to increase as climate change, and other factors, generate harsher environmental conditions in regions traditionally used for cultivation. Although breeding and genetically modified and edited organisms have generated many varieties with greater abiotic stress tolerance, their practical use depends on lengthy processes, such as biological cycles and legal aspects. On the other hand, a non-genetic approach to improve crop yield in stress conditions involves the exogenous application of natural compounds, including plant metabolites. In this review, we examine the recent literature related to the application of different natural primary (proline, l-tryptophan, glutathione, and citric acid) and secondary (polyols, ascorbic acid, lipoic acid, glycine betaine, α-tocopherol, and melatonin) plant metabolites in improving tolerance to abiotic stress. We focus on drought, saline, heavy metal, and temperature as environmental parameters that are forecast to become more extreme or frequent as the climate continues to alter. The benefits of such applications are often evaluated by measuring their effects on metabolic, biochemical, and morphological parameters in a variety of crop plants, which usually result in improved yields when applied in greenhouse conditions or in the field. As this strategy has proven to be an effective way to raise plant tolerance to abiotic stress, we also discuss the prospect of its widespread implementation in the short term.

show abstract

“…Cold stress is detrimental to plants as it directly affects the rate of nutrient and water uptake, which may lead to cell starvation, desiccation, and consequent death. Reduced metabolism, which occurs in cold tension, results in a photo-inhibition, inhibition of the activity of the photosystem II and destabilization of the phosphorus lipid bilayers thereby, affecting the normal architecture of cell membranes [44,114] [113]. Also, the application of such biostimulants having the ability to outcompete the ice-nucleating activity of microorganisms is becoming an effective method to overcome the losses caused by cold/frost damages [3].…”

Section: Cold Stressmentioning

confidence: 99%

Bacterial Plant Biostimulants: A Sustainable Way Towards Improving Growth, Productivity, and Health of Crops

Hamid¹,

Zaman²,

Farooq³

et al. 2021

Preprint

View full text Add to dashboard Cite

This review presents a comprehensive and systematic study of the field of bacterial plant biostimulants and considers the fundamental and innovative principles underlying this technology. Plant biostimulants are an important tool for modern agriculture as part of an integrated crop management (ICM) system; helping make agriculture more sustainable and resilient. Plant biostimulants contain substance(s) and/or microorganisms whose function when applied to plants or the rhizosphere, is to stimulate natural processes to enhance plant nutrient uptake, nutrient use efficiency, tolerance to abiotic stress, biocontrol, and crop quality. The use of plant biostimulants has gained substantial and significant heed worldwide as an environment-friendly alternative for sustainable agricultural production. Presently, there is an increasing curiosity of industry and researchers in microbial biostimulants especially, bacterial plant biostimulants (BPBs) to improve crop growth and productivity. The BPBs that are based on PGPR (plant growth-promoting rhizobacteria) play plausible roles to promote/stimulate the crop plant growth through several mechanisms that include, i) nutrient acquisition by nitrogen (N2) fixation and solubilization of insoluble minerals (P, K, Zn), organic acids and siderophores, ii) antimicrobial metabolites and various lytic enzymes, iii) action of growth regulators and stress-responsive/induced phytohormones, iv) ameliorating abiotic stress like drought, high soil salinity, extreme temperatures, oxidative stress, and heavy metals by using different modes of action, and v) plant defense induction modes. Presenting here is a brief review emphasizing the applicability of BPBs as an innovative exertion to fulfill the current food crisis.

show abstract

Important roles of glycinebetaine in stabilizing the structure and function of the photosystem II complex under abiotic stresses

Abstract: Main conclusion The molecular and physiological mechanisms of glycinebetaine stabilizing photosystem II complex under abiotic stresses are discussed, helping to address food shortage problems threatening the survival of growing population.

Cited by 55 publications

References 119 publications

Identification of Drought Tolerant and Molecular Analysis of DREB2A and BADH2 Genes and Yield Potensial of Lines from Single Crossing Bengkulu Local Rice Varieties

Identification of Drought Tolerant and Molecular Analysis of DREB2A and BADH2 Genes and Yield Potensial of Lines from Single Crossing Bengkulu Local Rice Varieties

Abiotic Stress in Crop Species: Improving Tolerance by Applying Plant Metabolites

Bacterial Plant Biostimulants: A Sustainable Way Towards Improving Growth, Productivity, and Health of Crops

Contact Info

Product

Resources

About