Pure honey has a good nutrient content and it is also believed it has ABSTRAKMadu murni mempunyai nilai gizi yang sangat baik dan dipercaya berkhasiat bagi kesehatan. Salah satu tanaman yang baik untuk beternak lebah madu adalah tanaman kopi. Madu yang dihasilkan dari nectar bunga kopi memiliki harga jual relatif tinggi. Untuk meningkatkan nilai tambah produk, perlu dilakukan penelitian untuk mendapatkan disain kemasan terbaik. Penelitian bertujuan untuk mengetahui gambaran dan pengaruh disain kemasan baik secara simultan maupun secara parsial terhadap keputusan pembelian konsumen madu murni. Hasil penelitian menunjukkan bahwa bahan kemasan yang ideal untuk produk madu murni bunga kopi adalah bahan kemasan botol jika dibanding dengan flexible packaging. Hal ini dikarenakan bahan kemasan botol mampu memenuhi fungsinya sebagai kemasan yang efisien dan efektif. Disain grafis juga memegang peranan penting dalam pemasaran produk. Secara grafis disain yang disukai oleh panelis adalah warna yang lebih kontras antara warna dasar label dengan bunga kopi yang ditampilkan. Ukuran huruf yang digunakan sudah baik, karena sudah terbaca dengan jelas. Kata kunci : madu, bahan kemasan, disain kemasan

[EFFECT OF WEED COMPOST AND SYNTHETIC FERTILIZER DOSAGE ON TOMATO GROWTH AND YIELD (Lycopersicum esculentum Mill.)]. The growth and yield of tomato plants are influenced by fertilizer and nutrient content in the soil. This study aims to investigate the effect of a combination of synthetic fertilizer and weed compost on the growth and yield of tomato plants. The study was conducted in November 2016 through June 2017 in Agronomy, Faculty of Agriculture, University of Bengkulu, at an altitude of ± 10 m above sea level using a Completely Randomized Design (CRD). The treatments consisted of  synthetic fertilizer at a rate of  180 kg/ha N, 150 kg/ha P2O5 and 100 kg/ha K2O (control), grass compost 30 , 40 and 50 tons/ha, 50% control + grass compost 15 tons/ha, 50% control + 20 tons/ha grass compost and 50% control + 25 tons/ha grass compost. The results revealed that the vegetative growth of tomato plants fertilized with grass compost 30 tons/ha and a combination of grass compost + 50% control did not differ from control treatment. Tomato yield fertilized with grass compost 30 tons/ha and a combination of 50% control + 15 tons/ha grass compost was higher than the control treatment. Therefore, 15 tons/ha of grass compost can reduce the dose of synthetic fertilizer by 50%.

Chili development in Indonesia faces several constraints, mainly low yields and disease incidents.  The improvement of chili traits through breeding programs requires information of genetic diversity, heritability,  genetic advance and gene role. A study was conducted to assess the values of variability and heritability of qualitative and quantitative traits of 20 genotypes of chilli plants. The study was conducted in May-September 2015 on Experimental Field of Faculty of Agriculture, the University of Bengkulu. The 20 chili genotypes were arranged factorially in a Randomized Complete Block Design, with three replications. The results showed that the qualitative characters that have broad sense of variability and heritability were plant height, days to flower, time to harvest, fruit length, fruit diameter, fruit weight, and weight of fruit per plant, indicating that a selection can be done on those variables. Variability on qualitative characters was found on the position of the flower stalk (3 kinds), corolla color (4 kinds), color of corolla holder (3 kinds), corolla shapes (2 kinds), anther colors (4 kinds), pistil colors (3 kinds), colors of young fruit and ripe fruit (3 kinds), and fruit position (3 kinds).

No abstract

Screening in the seedling stage of 39 progeny of F6 lines to drought stress was carried out in the greenhouse.  Drought tolerant and sensitive varieties of IR 20 and Salumpikit, respectively, were used as control plants.  The methods for traits identification of leaf curled, dried, and recovery ability after exposure to severe drought for two weeks was following the Standard Evaluation System (SES) developed by IRRI.  Molecular analysis to detect the presence of the DREB2A gene was carried out by PCR amplification of genomic DNA using forward- and reverse- oligonucleotide primers of CCTCATTGGGTCAGGAAGAA and GGATCTCAGCCACCCACTTA, respectively, while for BADH2 gene using forward- and reverse- oligonucleotide primers of GGCCAAGTACCTCAAGGCGA and TGTCCCCAGCTGCTTCATCC, respectively.  Molecular markers of DREB2A and BADH2 genes were also identified in 39 tested lines with approximately 250 and 2300 bp length, respectively.  This study concluded that the progeny of F6 lines generating from the crossing of local varieties of IR7858 and IR148 is the potential to become a drought-tolerant variety of upland rice. Line numbers BKL2 B-2-264-6 and BKL4 B-1-268-10 have a potential yield of more than 12 tonnes/ha. These line has the potential to be developed on rainfed lowland rice or dry land because it has drought resistance.