IN SILICO OLIGONUCLEOTIDE PRIMER DESIGN FOR Campylobacter jejuni cytolethal distending toxin B GENE AMPLIFICATION

Praja, Rian Ka

doi:10.30649/obj.v4i1.88

Cited by 4 publications

(6 citation statements)

References 11 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The first step in the PCR test process is primer design and this will determine the amplification performance of the PCR test (Praja, 2021). The following factors, including primer length, melting temperature, GC percentage, and other criteria, including the minimal amount of self-dimer, hairpin, repeat, and run, must be taken into consideration while creating the primer.…”

Section: Primer Designmentioning

confidence: 99%

See 1 more Smart Citation

Design of Specific Primer for Methallothionein Gene of Tor Fish (Tor tambra)

Atifah¹,

Achyar²

2023

Nat. Sci. J.

View full text Add to dashboard Cite

The use of heavy metal biomarkers is needed to detect and integrate heavy metals at the molecular level. Metallothionein gene is a gene that is expressed in fish organs that have been heavily polluted. The aim of the study was to find specific primers for methallothionein of tor fish. Detection of the metallothionein gene expression in PCR instruments requires a primer in the form of a short chain DNA sequence as a specific target DNA identifier. The primer design was performed in silico using the NCBI site and multiple-aligned using Geneious Prime bioinformatic software. Primers were designed according to the conserved region of these genes. The primers specificity was checked using Primer BLAST tools in NCBI. The results showed that the forward primer 1 (5'- GAT TGC GCC AAG ACT GGA ACT –3') and reverse primer 1 (5' – ATC ACG TTG ACC TCC TCA CTG -3') qualified as good primers with an amplicon size 186 bp.

show abstract

Section: Primer Designmentioning

confidence: 99%

“…In the PCR, a very important component needed is oligonucleotide primers. A good primer must have specific properties that are expected to amplify specific regions in the genome (Praja, 2021;Sint et al 2012). Along with the development of the NCBI GenBank database, primer design can be done using in silico approach.…”

Section: Introductionmentioning

confidence: 99%

Design of Specific Primer for Methallothionein Gene of Tor Fish (Tor tambra)

Atifah¹,

Achyar²

2023

Nat. Sci. J.

View full text Add to dashboard Cite

show abstract

“…Semua primer yang telah dianalisis menunjukkan hasil yang bervariasi dalam hal self-dimer, hairpin, repeat dan run (Tabel 1). Langkah pertama dalam proses tes PCR adalah desain primer dan ini akan menentukan amplifikasi kinerja tes PCR (Praja, 2021). Faktor-faktor yang terdapat didalamnya meliputi panjang primer, melting temperature, persentase GC, dan berbagai kriteria lainnya, termasuk jumlah minimum self-dimer, hairpin, repeat, dan run, harus dipertimbangkan dianalisis secara tepat saat melakukan desain primer.…”

Section: Hasil Dan Pembahasanunclassified

Design and Specificity Test of Specific Primers for Neuroglobin Gene Expression Modulation in Brain Tissue of Rattus norvegicus using qRT-PCR

Ramadhan,

Farikh,

Arrafi

et al. 2023

BSc

View full text Add to dashboard Cite

Neuroglobin (Ngb) is a newly discovered globin that is found in large numbers in neurons. Brain cells are very sensitive to lack of oxygen and can begin to die within five minutes after the oxygen supply is cut off. Hypoxic conditions of brain tissue are ischemic in the area of the bleeding center This study aims to design and test the specificity of the Neuroglobin Rattus norvegicus mRNA gene in silico as a nucleotide capable of reading neuroglobin gene expression. The neuroglobin gene sequence was obtained using a "nucleotide" search menu provided by NCBI GenBank and designed using Geneious Prime bioinformatics software. The neuroglobin gene sequence used in this study was Rattus norvegicus mRNA with accession number NM_033359.3|:1-1,773. Synthesized primary pairs are optimized using PCR gradients. PCR products were analyzed by electrophoresis using 1.5% agarose gel, 100 V for 27 minutes. The results obtained one forward primer for Rattus norvegicus neuroglobin (Ngb) which has a length of 20 bases with the order of 5' AGTCTTAGCCTCTCCCCCAG -3' and reverse primer has a length of 20 bases with the order of 5' GTCTACAGAACCACGGCACAcx-3' product size 803 bp. The difference Tm in this pair of primers is 0.9 0C. The gradient PCR results showed the thickest and clearest DNA bands were at 57.7°C. Primers with the best primary criteria for neuroglobin genes were obtained with an amplicon size of 803 bp and an aneealing temperature of 57.7 °C. The design results meet the requirements of good criteria so that the primary candidate design results can be used for the PCR process.

show abstract

“…Primer oligonukleotida merupakan komponen yang sangat penting dalam teknik PCR. Primer yang baik adalah primer yang memiliki sifat spesifik yang diharapkan mampu mengamplifikasi area spesifik dalam genom (Praja, 2021;Sint, Raso, & Traugott, 2012). Seiring dengan perkembangan basis data GenBank NCBI, desain primer kini dapat dilakukan dengan pendekatan in silico.…”

Section: Pendahuluanunclassified

“…Kisaran rating primer yang telah didesain berkisar 62 sampai 100 dan pasangan primer 6 adalah pasangan primer dengan rating tertinggi di antara semua primer yang didesain menggunakan Primer-BLAST (Tabel 3). Perancangan primer merupakan langkah awal yang menentukan performa amplifikasi dari sebuah proses uji PCR (Praja, 2021). Beberapa hal yang harus diperhatikan dalam mendesain primer yaitu panjang primer, suhu leleh, persentase GC serta kriteria lainnya yaitu jumlah self dimer, hairpin, repeat, and run yang rendah (Pradnyaniti, Wirajana, & Yowani, 2013;Saraswati et al, 2019).…”

Section: Perangkat Lunakunclassified

Perancangan primer gen lktB pada Fusobacterium necrophorum untuk analisis PCR

Praja

Rosalina

2021

J. Sains Tek. Peter.

Self Cite

View full text Add to dashboard Cite

Fusobacterium necrophorum is a pathogen causing disease in animals, especially cattle, goats, and sheep. F. necrophorum infection can result in a variety of necrotic conditions (necrobacillosis). This study aimed to design a pair of primers for detecting the leukotoxin B (lktB) gene expressed by F. necrophorum as diagnostic support. The lktB gene sequence was obtained from GenBank NCBI with accession number AF312861.3:685-2337. Furthermore, the sequence was used as a template for in silico primer design using Primer-BLAST. Primer candidates successfully designed were then analyzed for their secondary structure using NetPrimer. The results showed that forward primer set 6 (5'-TCGGATGCTGGAATGCTACTT-3') and reverse primer set 6 (5'-GGGCTCCCAAATCCTTACGA-3') were a favorable primer set with a product size of 228 bp. However, laboratory experiments need to be carried out to determine the optimal conditions for this primer set.

show abstract

IN SILICO OLIGONUCLEOTIDE PRIMER DESIGN FOR Campylobacter jejuni cytolethal distending toxin B GENE AMPLIFICATION

Cited by 4 publications

References 11 publications

Design of Specific Primer for Methallothionein Gene of Tor Fish (Tor tambra)

Design of Specific Primer for Methallothionein Gene of Tor Fish (Tor tambra)

Design and Specificity Test of Specific Primers for Neuroglobin Gene Expression Modulation in Brain Tissue of Rattus norvegicus using qRT-PCR

Perancangan primer gen lktB pada Fusobacterium necrophorum untuk analisis PCR

Contact Info

Product

Resources

About