Incidence and Ecology of Blackberry yellow vein associated virus

Abstract

Symptoms of leaf vein yellowing and bush decline in blackberry were attributed to infection by a novel crinivirus named Blackberry yellow vein associated virus (BYVaV). The disease is an emerging threat to blackberry production because it can cause substantial yield loss. The objective of this study was to identify the source and means of spread of BYVaV. A survey of blackberry plants for BYVaV from wild, cultivated, and nursery stocks was conducted. Insect traps and healthy blackberry sentinel plants were placed among symptomatic plants in a production field throughout two growing seasons to monitor the occurrence of potential vectors and virus spread. Virus indicator plants were grafted with BYVaV-infected blackberry because this virus was latent in some blackberry cultivars, but indicator plants failed to express symptoms when infected with BYVaV. Reverse-transcription polymerase chain reaction detection revealed the occurrence of BYVaV in blackberry nurseries in the United States, in production fields in Arkansas, South Carolina, and North Carolina, and in wild blackberry populations in Arkansas. Whiteflies (Trialeurodes packardii and T. ruborum), potential vectors of BYVaV, were observed on sticky traps placed in blackberry fields and were found colonizing blackberry plants; however, transmission studies failed to produce whitefly-mediated transmission of BYVaV. Further understanding of the disease etiology is needed to devise viable management strategies for this disease.

Epidemiology of criniviruses: an emerging problem in world agriculture

“…Symptoms of BYVD only occur when blackberry plants are infected with more than one virus. Symptoms include vein yellowing, oak-leaf or irregular patterns of chlorosis, ringspots, and line patterns ( Figure 3 ; Susaimuthu et al, 2007, 2008). Floricanes can also be severely affected leading to misshapen fruit and cane dieback.…”

A member of a new genus in the Potyviridae infects Rubus

“…For this reason we used aphids and mites for BYV transmission with negative results (data not shown). BVY-infected sentinel plants were asymptomatic, and detection by RT-PCR revealed that BYVaV, the originally described agent of BYVD, was not spreading in the field (Susaimuthu et al, 2007).…”

“…Surveys of wild blackberry plants indicated that BVY was present in symptomatic leaf samples of some of the wild blackberry plants (Rubus fruticosus, identified by Dr. Johnnie L. Gentry, University of Arkansas, Fayetteville) from two of the 19 Arkansas counties surveyed (Susaimuthu et al, 2007). The symptomatic wild blackberry plants that tested positive for BVY were also positive for BYVaV (Susaimuthu et al, 2007), and these samples were from wild blackberry plants in northwest Arkansas where the BYVD affected production field is located.…”

“…The symptomatic wild blackberry plants that tested positive for BVY were also positive for BYVaV (Susaimuthu et al, 2007), and these samples were from wild blackberry plants in northwest Arkansas where the BYVD affected production field is located. BVY was not detected in any of the other eight symptomatic cultivated blackberry plants from Georgia, Tennessee, Kentucky, South and North Carolina.…”

“…The RNA blots were prepared by dotting RNA on a nylon membrane as described (Susaimuthu et al, 2007). Probe DNA was synthesized by RT-PCR with primers BVY312F and BVY1105R (5 TATCTCCCCTCCTGCTCTCA 3 ) specific for BVY.…”