Incidence and Molecular Detection of Greening Disease in Two Citrus Cultivars in Sargodha, Pakistan

Abstract

C itrus is infected by several different pathogens, including fungi, prokaryotes, viruses, nematodes, and virus-like pathogens (Khan et al., 2016). Among these pathogens, the citrus greening disease is one of the most devastating and widely distributed pathogens in citrus orchards of significant citrus-growing areas of the world and Pakistan (Iftikhar et al., 2016;Saifullah et al., 2015). Citrus greening (CGD) disease is now alternatively termed as Huanglongbing (HLB) and is known with different names in different countries owing to their local languages. All the citrus cultivars are affected by this disease regardless of the rootstock. This graft transmissible disease can also be transmitted through an insect vector very efficiently (Graca, 1991;Batool et al., 2007). HLB being a century-old disease, probably originated at the end of the 19 th century in China (Batool et al., 2007; Bove, 2006). The greening disease is caused by gram-negative unculturable phloem limited bacterium (Murray and Schlifer, 1994) named Candidatus liberibacter. Jagoueix et al.

Phytogenic Selenium Nanoparticles Elicited the Physiological, Biochemical, and Antioxidant Defense System Amelioration of Huanglongbing-Infected ‘Kinnow’ Mandarin Plants

“…In Pakistan, HLB disease incidence ranges between 4.6 and 24% among the ‘Mosambi’ and ‘Kinnow’ mandarin plants. In the recent past, it has also been reported that HLB is a major threat to citriculture among distinguished tehsils of the district of Sargodha, i.e., Bhera, Bhalwal, Shahpur, Kotmomin, Sillanwali, and Sahiwal [ 14 ]. There is currently no proper cure, and unique managing strategies have not been established to cure HLB disease.…”

Morpho-chemical characterization of Huanglongbing in mandarin (Citrus reticulata) and orange (Citrus sinensis) varieties from Pakistan

“…All the morphological and biochemical characterization was done on 200 samples with different disease symptoms and severity levels from trees with available fruits and marked symptoms. Healthy fruits and leaves samples were also compared with diseased samples taken from 200 samples from 10 trees which were PCR assessed by using protocols and primers described by Sajid et al (2021). The primer pairs used were A2 (F) (TATAAAGGTTGACCTTTCGAGTTT) and J5 (R) (ACAAAAGCAGAAATAGCACGAACAA) described by Hocquellet et al (1999), which generate an amplicon DNA band of 703 bp.…”

“…These negative impact of HLB can be minimized by using the tolerant rootstock. In a previous study, PCR detected the Candidatus Liberibacter asiaticus in HLB-infected citrus samples and showed genetic variation in HLB-infected samples of highly planted citrus varieties, 'Kinnow' mandarin (Citrus reticulata Blanco) and 'Mosambi' orange (C. sinensis (L.) Osbeck), upon sequencing (Sajid et al, 2021) from citrus orchards of Punjab, Pakistan. These two cultivars, mandarin and orange, shared the greatest amount of citrus production in Pakistan (Nawaz et al, 2020).…”

“…The export of citrus is an important source of foreign exchange (Iftikhar et al, 2021), because citrus industry in Pakistan represents 2.89 million metric tons in production. From the Pakistan citrus growing areas, Punjab province has vital role in contribution of more than 95% this production (Sajid et al, 2021). Although Pakistan is among the top 16 leading citrus producing countries, but its production has been affected by or citrus greening disease (CGD) (syn.…”

“…Although Pakistan is among the top 16 leading citrus producing countries, but its production has been affected by or citrus greening disease (CGD) (syn. Huanglongbing, HLB) since late 80's (Catara et al, 1988), which is a real threat to the citrus industry not only in Pakistan but also in the world (Bove, 2006;Gottwald et al, 2007;Sajid et al, 2021). This disease debilitates the tree and has a bad impact on the flowering, tree vigor, nutrient uptake, fruit quality, and yield of infected plants (Gottwald et al, 2007).…”