Inhibition of B16BL6 tumor progression by coadministration of recombinant angiostatin K1-3 and endostatin genes with cationic liposomes

Abstract

Transfection of the antiangiogenic angiostatin and endostatin genes was shown to be an alternative to high-dose administration of angiostatin or endostatin proteins for cancer therapy. We have systematically investigated whether coadministration of the mouse angiostatin kringle 1-3 gene (pFLAG-AngioK1/3) and the endostatin gene (pFLAG-Endo) complexed with cationic liposomes exhibits enhanced therapeutic efficacy. In vitro, the coexpressed mixture of angiostatin K1-3 and endostatin more effectively reduced angiogenesis in chorioallantoic membranes than either angiostatin K1-3 or endostatin alone. In vivo, subcutaneous coadministration of pFLAG-AngioK1/3 and pFLAG-Endo lipoplexes more effectively inhibited vascularization in Matrigel plugs implanted in mice than either one alone. Additionally, subcutaneous administration of these genes inhibited the growth and formation of pulmonary metastases of B16BL6 melanoma cells in mice. Compared to treatment with an empty vector, treatment with pFLAG-AngioK1/3 plus pFLAG-Endo inhibited 81% of tumor growth, while treatment with pFLAG-AngioK1/3 or pFLAG-Endo inhibited tumor growth 70 and 69%, respectively. Cotreatment with the two plasmids after primary tumor excision induced a 90% inhibition of pulmonary metastases versus 79% for pFLAG-AngioK1/3 or 80% for pFLAG-Endo individually. These results suggest that combined administration of angiostatin K1-3 and endostatin genes complexed with cationic liposomes may be an innovated antiangiogenic strategy for cancer therapy.

Inhibition of angiogenesis and tumor progression by hydrodynamic cotransfection of angiostatin K1-3, endostatin, and saxatilin genes

“…16,24 In this report, inhibition of in vivo angiogenesis in Matrigel containing tumor cells by the three antiangiogenic proteins provided more conclusive evidence to support their synergistic (or additive) antineovascularization activity. The mechanical explanation for the enhanced inhibition of angiogenesis by the three different components is, as yet, not completely clear.…”

“…16,17 Mouse angiostatin cDNA encoding the plasminogen amino acid residues 98-352 (Kringles 1-3, K1-3), was synthesized by a standard polymerase chain reaction (PCR) using the sense primer 5 0 -GGGGGTACCGTG TATCTGTCAGAATGTAAGACCG and the antisense primer 3 0 -GGGTCTAGAGCAGGATGGAATCTCA CAGTACTC. The PCR fragment was cloned into the pFLAG-CMV-1 vector (KODAK, New Haven, CT) and the construct designated as pFLAG-AngioK1/3.…”

“…Meanwhile, angiostatin K1-3, endostatin, and/or saxatilin genes were transfected to 293 transformed human kidney cells using the DOTAP/Chol lipoplex as described previously. 16 The culture medium containing angiostatin K1-3, endostatin, and/or saxatilin that had been expressed from the transfected 293 cells (0.5 ml) was added to the B16BL6 cells. The width of the injury line was observed microscopically at  40 magnification and the distance between the borders was measured (t 0 ) along the well.…”

Gene therapy for hepatocellular carcinoma using sonoporation enhanced by contrast agents

“…29,30 Currently, some studies have reported that commercially available transfection reagents (i.e., Lipoplexes) have proved useful for nonviral gene therapy. [31][32][33][34][35] We too are very interested in these reagents. Nevertheless, we expect that targeted gene therapy by sonoporation using contrast agents for HCC would be a much easier method, based on our experience using contrast agents to detect hepatic tumors by US examination in clinical situations.…”

Targeted gene therapy of LS174 T human colon carcinoma by anti-TAG-72 immunoliposomes

“…Plasmid production Plasmids pAAV-CMV-Luc, 16 pEGFP-N1 (Clontech Laboratories, Inc., Mountain View, CA), pFALGAngioK1/3, 16-18 pFLAG-Endo [16][17][18] and pFLAG-Sax 17 were propagated in DH5a strain of E. coli under selective LB media supplemented with ampicillin and kanamycin. The plasmids were isolated and purified with a Qiagen Endo-free plasmid megaprep kit (Qiagen, Valencia, CA).…”