Interaction of Autographa californica Multiple Nucleopolyhedrovirus Cathepsin Protease Progenitor (proV-CATH) with Insect Baculovirus Chitinase as a Mechanism for proV-CATH Cellular Retention

Self Cite

The binding of Autographa californica multiple nucleopolyhedrovirus chitinase (CHIA) to viral cathepsin protease progenitor (proV-CATH) governs cellular/endoplasmic reticulum (ER) coretention of CHIA and proV-CATH, thus coordinating simultaneous cellular release of both host tissue-degrading enzymes upon host cell death. CHIA is a proposed proV-CATH folding chaperone because insertional inactivation of chiA causes production of proV-CATH aggregates that are incompetent for proteolytic maturation into active V-CATH enzyme. We wanted to determine whether the N-terminal chitin-binding domain (CBD, 149 residues) and C-terminal CHIA active-site domain (ASD, 402 residues) of CHIA bind to proV-CATH independently of one another and whether either domain is dispensable for CHIA's putative proV-CATH folding chaperone activity. We demonstrate that N-terminally green fluorescent protein (GFP)-fused CHIA, ASD, and CBD each colocalize with proV-CATH-RFP in ER-like patterns and that both ASD and CBD independently associate with proV-CATH in vivo using bimolecular fluorescence complementation (BiFC) and in vitro using reciprocal nickel-histidine pulldown assays. Altogether, the data from colocalization, BiFC, and reciprocal copurification analyses suggest specific and independent interactions between proV-CATH and both domains of CHIA. These data also demonstrate that either CHIA domain is dispensable for normal proV-CATH processing. Furthermore, in contrast to prior evidence suggesting that a lack of chiA expression causes proV-CATH to become aggregated, insoluble, and unable to mature into V-CATH, a chiA deletion bacmid virus we engineered to express just v-cath produced soluble proV-CATH that was prematurely secreted from cells and proteolytically matured into active V-CATH enzyme.

mentioning

confidence: 99%

Role of Interactions between Autographa californica Multiple Nucleopolyhedrovirus Procathepsin and Chitinase Chitin-Binding or Active-Site Domains in Viral Cathepsin Processing

Hodgson

Arif

Krell

2013

Self Cite

“…In addition to genes that regulate and/or mediate viral transcription, translation, and DNA replication, the virus also encodes a variety of genes that modify cellular and organismal physiology, architecture, and defenses. These viral manipulations include effects on development and behavior of the host insect through hormonal control and perhaps other mechanisms (11)(12)(13)(14), a profound modification of cellular physiology and architecture (15)(16)(17), and host tissue breakdown, which results in release of the virus into the environment (18)(19)(20)(21). The AcMNPV infection is completed in a relatively short time period (approximately 24 to 48 h), producing infectious budded and occluded viruses.…”

mentioning

confidence: 99%

Transcriptome Responses of the Host Trichoplusia ni to Infection by the Baculovirus Autographa californica Multiple Nucleopolyhedrovirus

Chen

Zhong

Fei

et al. 2014

Productive infection of Trichoplusia ni cells by the baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) leads to expression of ϳ156 viral genes and results in dramatic cell remodeling. How the cell transcriptome responds to viral infection was unknown due to the lack of a reference genome and transcriptome for T. ni. We used an ϳ60-Gb RNA sequencing (RNA-seq) data set from infected and uninfected T. ni cells to generate and annotate a de novo transcriptome assembly of approximately 70,322 T. ni unigenes (assembled transcripts), representing the 48-h infection cycle. Using differential gene expression analysis, we found that the majority of host transcripts were downregulated after 6 h postinfection (p.i.) and throughout the remainder of the infection. In contrast, 5.7% (4,028) of the T. ni unigenes were upregulated during the early period (0 to 6 h p.i.), followed by a decrease through the remainder of the infection cycle. Also, a small subset of genes related to metabolism and stress response showed a significant elevation of transcript levels at 18 and 24 h p.i. but a decrease thereafter. We also examined the responses of genes belonging to a number of specific pathways of interest, including stress responses, apoptosis, immunity, and protein trafficking. We identified specific pathway members that were upregulated during the early phase of the infection. Combined with the parallel analysis of AcMNPV expression, these results provide both a broad and a detailed view of how baculovirus infection impacts the host cell transcriptome to evade cellular defensive responses, to modify cellular biosynthetic pathways, and to remodel cell structure. IMPORTANCEBaculoviruses are insect-specific DNA viruses that are highly pathogenic to their insect hosts. In addition to their use for biological control of certain insects, baculoviruses also serve as viral vectors for numerous biotechnological applications, such as mammalian cell transduction and protein expression for vaccine production. While there is considerable information regarding viral gene expression in infected cells, little is known regarding responses of the host cell to baculovirus infection. In these studies, we assembled a cell transcriptome from the host Trichoplusia ni and used that transcriptome to analyze changes in host cell gene expression throughout the infection cycle. The study was performed in parallel with a prior study of changes in viral gene expression. Combined, these studies provide an unprecedented new level of detail and an overview of events in the infection cycle, and they will stimulate new experimental approaches to understand, modify, and utilize baculoviruses for a variety of applications.

“…To indicate the localization of the ER in Sf9 cells, a fragment containing the mCherry ORF fused with the signal peptide of AcMNPV chitinase at its N terminus and an ER retention signal (KDEL) at its C terminus (15)(16)(17) was amplified from the pCMV-mCherry plasmid (Clontech) with primers mCherry-KDEL-F (5=-GGATCCATGTTGTACAAATTGT TAAACGTTTTGTGGTTGGTCGCCGTTTCTAACGCGATTCCCGGC ACGATGGTGAGCAAGGGCG-3= [the BamHI site is underlined]) and mCherry-KDEL-R (5=-GAATTCTCACAGCTCGTCCTTCTCGCTCTT GTACAGCTCGTCCATGCC-3= [the EcoRI site is underlined]). The PCR product was cloned into pIB/V5-His to generate the pIB-mCherry-KDEL (pIB-mCh-KDEL) plasmid.…”

mentioning

confidence: 99%

Autographa californicaNucleopolyhedrovirus Ac76: a Dimeric Type II Integral Membrane Protein That Contains an Inner Nuclear Membrane-Sorting Motif

Wei

Wang

Zhang

et al. 2014

Our previous study showed that the Autographa californica nucleopolyhedrovirus (AcMNPV) ac76 gene is essential for both budded virion (BV) and occlusion-derived virion (ODV) development. More importantly, deletion of ac76 affects intranuclear microvesicle formation. However, the exact role by which ac76 affects virion morphogenesis remains unknown. In this report, we characterized the expression, distribution, and topology of Ac76 to further understand the functional role of Ac76 in virion morphogenesis. Ac76 contains an ␣-helical transmembrane domain, and phase separation showed that it was an integral membrane protein. In AcMNPV-infected cells, Ac76 was detected as a stable dimer that was resistant to SDS and thermal denaturation, and only a trace amount of monomer was detected. A coimmunoprecipitation assay demonstrated the dimerization of Ac76 by high-affinity self-association. Western blot analyses of purified virions and their nucleocapsid and envelope fractions showed that Ac76 was associated with the envelope fractions of both BVs and ODVs. Immunoelectron microscopy revealed that Ac76 was localized to the plasma membrane, endoplasmic reticulum (ER), nuclear membrane, intranuclear microvesicles, and ODV envelope. Amino acids 15 to 48 of Ac76 were identified as an atypical inner nuclear membrane-sorting motif because it was sufficient to target fusion proteins to the ER and nuclear membrane in the absence of viral infection and to the intranuclear microvesicles and ODV envelope during infection. Topology analysis of Ac76 by selective permeabilization showed that Ac76 was a type II integral membrane protein with an N terminus exposed to the cytosol and a C terminus hidden in the ER lumen.