Interaction of two nonhistone proteins with the estradiol response element of the avian vitellogenin gene modulates the binding of estradiol-receptor complex.

Abstract

The DNA sequence corresponding to the estradiol response element has been synthesized and tested in vitro for the binding of specific proteins. Gel retardation experiments combined with dimethyl sulfate protection experiments revealed that this region binds two nonhistone proteins (NHPs). One of them, NHP-1, has a molecular weight of 70,000 and binds specifically to the dyad symmetry sequence GGTCAGCGTGACC. The NHP-1 can be separated from the estradiol receptor chromatographically; it does not bind estradiol and does not cross-react with an antibody directed against the estradiol receptor. A series of synthetic "mutant" oligonucleotides were tested in a protein-DNA binding competition assay. Deletion of the GCG in the center of the dyad symmetry sequence suppressed the binding of NHP-1 by 90%, and the conversion of any GC pair to an AT pair decreased the affinity of the binding site for NHP-1. Methylation of the two CpGs on both strands of the dyad symmetry sequence decreased the affinity of the binding site for NHP-1 by 60%, whereas hemimethylation of the same structure did not inhibit the binding of NHP-1. NHP-1 and NHP-2, the NHP binding to the DNA next to the dyad symmetry sequence, bind exclusively to double-stranded DNA. NHP-2 has a molecular weight of 60,000. NHP-1 and NHP-2 are neither tissue nor species specific. In vitro reconstitution experiments show that NHP-1 and NHP-2 increase the binding efficiency of the estradiolreceptor complex to the estradiol response element.A sequence situated 600 base pairs upstream of the avian vitellogenin gene preferentially binds purified nuclear estradiol-receptor complex (1). Comparison of the 5'-flanking sequence ofXenopus and chicken vitellogenin genes and very low density apolipoprotein II genes revealed a region of homology that consisted of the dyad symmetry sequence GGTCANNNTGACC (2). Its location upstream of the avian vitellogenin gene coincided with the estradiol-receptor complex binding site. Ligation of the equivalent region of the Xenopus vitellogenin gene to a thymidine kinase promoterchloramphenicol acetyltransferase gene fusion and transient expression in the estradiol-responsive human breast cancer cell line MCF7 has demonstrated that this sequence is an essential part of the estradiol response element (ERE) (3, 4).During activation of the vitellogenin gene by estradiol, the region including the ERE becomes associated with the nuclear matrix (5), and two CpGs within the dyad symmetry sequence are demethylated in a strand-specific manner (6). The functional complexity ofthis important regulatory region suggested that the ERE may bind other proteins. Moreover, DNase I "footprinting" experiments (1) and the electron microscopy studies of the protein-DNA interactions at the ERE of the Xenopus vitellogenin gene (7) also indicate that the protein-DNA complexes formed at the ERE are large and may include other proteins besides hormone receptor. This paper shows that two nonhistone proteins (NHPs) bind with high affinity to the ERE of the avian vitell...

Myb-Ets Fusion Oncoprotein Inhibits Thyroid Hormone Receptor/c-ErbA and Retinoic Acid Receptor Functions: a Novel Mechanism of Action for Leukemogenic Transformation by E26 Avian Retrovirus

“…The pTRE-GCAT reporter plasmid was constructed by insertion of the double-stranded synthetic oligonucleotide TCAGGTCATGACCTGA, corresponding to the palindromic hormone response element (HRE) TREpal (26) upstream of the Ϫ109/Ϫ9 sequence of the rabbit ␤-globin promoter (59). The pERE-GCAT plasmid was constructed similarly with the estrogen response element from the chicken vitellogenin II gene promoter, TCCTGGTCAGCGT GACCGGAG (20). The DR4-tkCAT construct was obtained by insertion of the GGTAGGGTTCACGAAAGTTCACTC double-stranded sequence, containing a DR4 T3 response element, upstream of the thymidin kinase (TK) promoter of pBLCAT8 ϩ .…”

Non‐histone protein 1 (NHP1) is a member of the Ku protein family which is upregulated in differentiating mouse myoblasts and human promyelocytes

“…We have shown previously that NHP1 binds in a sequenceindependent manner and with a high binding affinity to DNA containing CpG base pairs [1,2]. The binding activity of NHP1 increases more than 2-fold in the liver of estradiol treated immature roosters where it coincides with the active demethylation of CpGs situated within the promoter region of the vitellogenin gene [4].…”

“…NHP1 can be separated from the estradiol receptor chromatographically and it neither binds estradiol nor cross reacts with antibodies directed against estradiol receptor. Deletion of the CpG in the center of the dyad symmetry sequence of the ERE decreased the binding of NHP1 by 90% and a conversion of any GC pair to an AT pair diminished the affinity of the binding site for NHP1 [1]. In the purified form, but not in the pure form, NHP1 was shown to produce nicks around the central CpG of the ERE [2] indicating that NHP1 might play a role in the active demethylation of mCpGs.…”

“…Fax: (41) of the avian vitellogenin gene in the liver there was a transient increase in NHP1 binding activity [4]. It has also been suggested that NHP1 could tag the DNA for the subsequent binding of the estradiol receptor [1][2][3]. A possible involvement of NHP1 in a general mechanism of active demethylation could account for its apparent ubiquity.…”

“…Non-histone protein 1 (NHP1) was first detected as a protein with a very high affinity to the estrogen response element (ERE) of the avian vitellogenin gene [1][2][3]. The strongest contact points of NHP1 with the ERE were with 5' AGCG 3' in the center of the palindrome differing from those of the estradiol receptor (ER) [2].…”