Intra-articular lentivirus-mediated delivery of galectin-3 shRNA and galectin-1 gene ameliorates collagen-induced arthritis

Abstract

Different members of the galectin family may have inhibitory or stimulatory roles in controlling immune responses and regulating inflammatory reactions in autoimmune diseases such as rheumatoid arthritis (RA). A hypothetical model of a cross talk between galectin-1 and galectin-3 has been established in the circumstance of rheumatoid joints. As galectin-3 is a positive regulator and galectin-1 is a negative regulator of inflammation and autoimmune responses, in this study we evaluated the effects of local knockdown of galectin-3 or overexpression of galectin-1 on ameliorating collagen-induced arthritis (CIA) in rats. Lentiviral vectors encoding galectin-3 small hairpin RNA (shRNA) and galectin-1, as well as two control vectors expressing luciferase shRNA and green fluorescent protein, were individually injected intra-articularly into the ankle joints of rats with CIA, and their treatment responses were monitored by measuring the clinical, radiological and histological changes. Our results show that both knockdown of galectin-3 and overexpression of galectin-1 induced higher percentages of antigen-induced T-cell death in the lymph node cells from arthritic rats. Furthermore, these treatments significantly reduced articular index scores, radiographic scores and histological scores, accompanied with decreased T-cell infiltrates and reduced microvessel density in the ankle joints. Our findings implicate galectin-3 and galectin-1 as potential therapeutic targets for the treatment of RA.

Suppression of collagen-induced arthritis by intra-articular lentiviral vector-mediated delivery of Toll-like receptor 7 short hairpin RNA gene

“…On the basis of the titers of TU and viral particle for our recombinant lentiviruses, 2000 viral particle approximately equals to 1 TU. 24 The efficacy of knocking down the TLR7 expression was confirmed by the transfection of circulating mononuclear cells from CIA rats (day 12 after the first immunization) with the Lt.shTLR7 vector or scramble control at the multiplicities of infection of 10 for 48 h with a 91.3% reduction of expression levels by using the western blot analysis (ratio of TLR7 to b-actin, Lt.shTLR7 vs Lt.scramble, 0.59 vs 6.81).…”

“…24 The heteroduplexes supplied as 60 nucleotides oligodeoxynucleotides were annealed and inserted downstream of the H1 promoter into pSuper vector (Oligoengine) at the BglII and HindIII sites to generate pSuper/shTLR7. After the screening, the shRNA expression cassette containing the sequences for H1 promoter and shTLR7 (sense 5¢-GATC CCCCAACAACCGGCTTGATTTATTCAAGAGATAAATCAAGCCGGTTGTTTT TA-3¢ and antisense 5¢-AGCTTAAAAACAACAACCGGCTTGATTTATCTCTT GAATAAATCAAGCCGGTTGTTGGGG-3¢) was recovered from the pSuper/ shTLR7 plasmid by EcoRI and ClaI digestion, and further ligated by T4 DNA ligase (Invitrogen, Carlsbad, CA, USA) into the same site of lentiviral transfer plasmid pLVTHM (a kind gift from Dr D Trono, Ecole Polytechnique Fédérale de Lausanne, Lausanne, Switzerland), resulting in the pLVTHM/shTLR7 (Lt.shTLR7) plasmid expressing both TLR7 shRNA and green fluorescent protein (GFP).…”

“…23,24 The i.a. injection is a simple and efficient method for delivery of genes into the inflamed joints, and a direct genetic modification can take place following such a manipulation.…”

Activation of free fatty acid receptor 1 improves hepatic steatosis through a p38-dependent pathway

“…Briefly, the lentiviral vectors with shRNA for human FFAR1 were purchased from OriGene Technologies (Rockville, MD, USA). Lentivirus production was performed as described previously (Wang et al 2010). In brief, lentiviral vectors were transiently transfected with the packaging plasmid pSPAX2 and the VSV expression plasmid pMD2.G into 293T cells using calcium phosphate precipitation.…”

Gene Therapy Challenges in Arthritis

“…The second class called lentivirus is able to easily transfect cells and then to produce the transgene for a long time. Several studies have shown that an i.a injection of lentivirus (encoding therapeutic molecules) decreases the development of arthritis in animal models (Gouze et al, 2003;Wang et al, 2010;Zondervan et al, 2008). Furthermore, lentivirus [encoding both a therapeutic molecule (galectin 1) and the shRNA of (galectin 3)] has been injected in the joint of arthritic mice .…”