Invasion of shoot apical meristems by Chrysanthemum stunt viroid differs among Argyranthemum cultivars

Abstract

Chrysanthemum stunt viroid (CSVd) is a damaging pathogen attacking Argyranthemum plants. Our study attempted to reveal distribution patterns of CSVd in shoot apical meristems (SAM) and to explore reasons for differential ability of CSVd to invade SAM of selected Argyranthemum cultivars. Symptom development was also observed on greenhouse-grown Argyranthemum plants. Viroid localization using in situ hybridization revealed that the ability of CSVd to invade SAM differed among cultivars. In diseased ‘Yellow Empire’ and ‘Butterfly’, CSVd was found in all tissues including the uppermost cell layers in the apical dome (AD) and the youngest leaf primordia 1 and 2. In diseased ‘Border Dark Red’ and ‘Border Pink’, CSVd was detected in the lower part of the AD and elder leaf primordia, leaving the upper part of the AD, and leaf primordia 1 and 2 free of viroid. Histological observations and transmission electron microscopy showed similar developmental patterns of vascular tissues and plasmodesmata (PD) in the SAM of ‘Yellow Empire’ and ‘Border Dark Red’, while immunolocalization studies revealed a major difference in the number of callose (β-1, 3-glucan) particles deposited at PD in SAM. A lower number of callose particles were found deposited at PD of SAM of ‘Yellow Empire’ than ‘Border Dark Red’. This difference is most likely responsible for the differences in ability of CSVd to invade SAM among Argyranthemum cultivars.

Low Temperature Treatment Affects Concentration and Distribution of Chrysanthemum Stunt Viroid in Argyranthemum

“…CSVd travels long distance through the phloem of the infected host plants. We also found CSVd could invade SAM of in vitro grown ‘Border Dark Red’, including elder tissues and LPs, but not AD, and CSVd can invade throughout the whole SAM of ‘Yellow Empire’, including the AD, which is the same as in vivo grown plants ( Zhang et al, 2015 ).…”

“…Chrysanthemum stunt viroid strand-specific digoxigenin (DIG)-11-UTP labeled probes were synthesized from a recombinant plasmid (PCSVd2) containing a 188 nucleotides fragment, amplified with the forward primer (5′–3′ CGGGACTTACTGTGGTTCC) and the reverse primer (5′–3′ GGAAGGGTGAAAACCCTGTT), of the CSVd genome by in vitro transcription ( Zhang et al, 2015 ). In situ hybridization was performed according to Zhang et al (2015) . Briefly, ten of each sample, including low-temperature treated shoot tips, flowers and stems of both ‘Border Dark Red’ and ‘Yellow Empire’, were fixed, dehydrated, and paraffin embedded.…”

“…Localization of potato spindle tuber viroid (PSTVd) has been reported in flowers and stems in tomato and Nicotiana benthamiana ( Zhu et al, 2001 ; Matsushita et al, 2011 ). Previously, we found that the ability of CSVd to invade SAMs varied among Argyranthemum cultivars ( Zhang et al, 2015 ). However, no systematic localization for CSVd has been done until now.…”

“…Chrysanthemum stunt viroid (CSVd), a member of the family Pospiviroidae ( Bouwen and van Zaayen, 2003 ), can attack several ornamental crops, including Chrysanthemum ( Bouwen and van Zaayen, 2003 ), Argyranthemum ( Zhang et al, 2015 ), Dahlia ( Nakashima et al, 2007 ), and Petunia ( Verhoeven et al, 1998 ). Infection by CSVd can result in unmarketable plants and low yield of flowers ( Marais et al, 2011 ; Jeon et al, 2012 ; Matsushita, 2013 ; Savitri et al, 2013 ; Zhang et al, 2015 ), and possibly to considerable losses. CSVd is also listed as one of the quarantine pathogens in the European Union’s Plant Health Directive (2000/29/EC) ( Cho et al, 2013 ).…”

“…Viroids are efficiently transmitted by vegetative propagation of host plants, thus resulting in viroid transmission from generation to generation. Use of viroid-free materials is essential for a sustainable production of vegetatively propagated plants ( Zhang et al, 2015 ). To date, several methods have been developed for production of viroid-free plants, including low temperature therapy ( El-Dougdoug et al, 2010 ; Savitri et al, 2013 ), thermotherapy ( Jeon et al, 2012 ), leaf primordium (LP)-free shoot apical meristem (SAM) culture ( Hosokawa et al, 2004a , b ), chemotherapy ( Savitri et al, 2013 ), and cryotherapy ( Jeon et al, 2015 ).…”