Isolation and characterization of microsatellite loci for the jack mackerel (Trachurus murphyi Nichols, 1920)

Canales‐Aguirre, Cristian B.; Ferrada, Sandra; Galleguillos, Ricardo

doi:10.1007/s10592-009-9932-y

Cited by 8 publications

(6 citation statements)

References 3 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Individuals were analysed at 10 microsatellite loci, four of which (Tt29, Tt48, Tt62, Tt113) were developed for T. trachurus (Kasapidis & Magoulas, ) and six (TmurA101, TmurA104, TmurA115, TmurB104, TmurB116, TmurC4) for T. murphyi (Canales‐Aguirre et al ., ). Loci were individually PCR amplified in 10 μl reaction volumes containing 50–100 ng template DNA, 1 pmol of each primer, 5 μl of 2XBioMix (Bioline, UK) and 1 μl of ddH 2 O.…”

Section: Methodsmentioning

confidence: 99%

Genetic analysis provides insights into species distribution and population structure in East Atlantic horse mackerel (Trachurus trachurus and T. capensis)

Healey

Farthing

Nunoo

et al. 2020

Journal of Fish Biology

View full text Add to dashboard Cite

Two sister species of horse mackerel (Trachurus trachurus and T. capensis) are described that are intensively harvested in East Atlantic waters. To address long‐standing uncertainties as to their respective geographical ranges, overlap and intraspecific population structure this study combined genetic (mitochondrial DNA and microsatellite) analysis and targeted sampling of the hitherto understudied West African coast. mtDNA revealed two reciprocally monophyletic clades corresponding to each species with interspecies nuclear differentiation supported by FST values. The T. trachurus clade was found across the north‐east Atlantic down to Ghana but was absent from Angolan and South African samples. The T. capensis clade was found only in South Africa, Angola and a single Ghanaian individual. This pattern suggests that both species may overlap in the waters around Ghana. The potential for cryptic hybridization and/or indiscriminate harvesting of both species in the region is discussed. For T. capensis mtDNA supports high gene flow across the Benguela upwelling system, which fits with the species' ecology. The data add to evidence of a lack of significant genetic structure throughout the range of T. trachurus though the assumption of demographic panmixia is cautioned against. For both species, resolution of stock recruitment heterogeneity relevant to fishery management, as well as potential hybridization, will require more powerful genomic analyses.

show abstract

Section: Methodsmentioning

confidence: 99%

Genetic analysis provides insights into species distribution and population structure in East Atlantic horse mackerel (Trachurus trachurus and T. capensis)

Healey

Farthing

Nunoo

et al. 2020

Journal of Fish Biology

View full text Add to dashboard Cite

show abstract

“…The Wahlund effect has been suggested as a cause for heterozygous deficiency, (Johnson and Black, 1984;Pritchard et al 2000;Valles-Jimenez et al 2005;Zelenina & Rastorguev, 2010;Buryakova & Glubokov, 2011;Bekkevold et al 2011;Afanaziev, et al 2012 andOvenden, 2013). The results shows the presence of null alleles as indicated by the low F is values (homozygous deficit) and this is a common problem in population studies using microsatellites, (Hauser et al 2002;Ball and Chapman 1998;Burridge and Smolenski, 2003;Cristian et al 2009;Tzeng et al 2009;Bekkevold et al 2011;.Nugroho et al 2011). Assortative mating and reproductive success (Supungul et al 2000) could lead to inbreeding and HW disequilibrium.…”

Section: Discussionmentioning

confidence: 99%

“…Two microsatellite loci, TmurA115 TG (28) Genbank (FJ668658) F: GTCACTGGAGCAATCAATAGAC R: TGCAATGTTACATGACTCAGAG and TmurB104 F: TGAAGCACAAGTTTCCAAATC ATC (14) Genbnk (FJ668661) R: AAAGGTCAGAGAGAGAACAACG developed by Cristian et al (2009) were used in this study. Mendelian inheritance mode of these loci in all families was studied.…”

Section: Microsatellite Analysismentioning

confidence: 99%

Genetic divergence in Trachurus indicus (Nekrasov, 1966) and Decapterus maruadsi (Temminck & Schlegel, 1843) , Family: Carangidae dwelling the Gulf of Suez, Red Sea

Megahed¹,

Sabrah²,

Abo-El-Maaty³

et al. 2019

Egypt. J. of Aquatic Biolo. and Fish.

View full text Add to dashboard Cite

Gulf of Suez Microsatellite genetic divergenceFamily Carangidae is widely distributed in the Atlantic, Indian and pacific Oceans. Two morphologically similar species, Trachurus indicus and Decapterus maruadsi, were collected and recognized from the Gulf of Suez. The two species have no distinct differences morphologically. Microsatellite DNA markers revealed that the populations of the two species represented distinct genetic divergence. This genetic diversity study showed that the populations of the two species are not related to each other. Overall, this study reveals high genetic diversity of T. indicus and D. maruadsi populations. Further studies on the genetic structure of these two species, are needed not only to understand the evolutionary history of the species, but also to improve the knowledge-based fishery management programs of this important biological resources.

show abstract

“…The average values of Na , Ho , He , and PIC of these 33 loci were 12.6, 0.723, 0.827, and 0.794, respectively. These genetic parameters were nearly equivalent to those previously reported for 11 di‐nucleotide repeat SSRs ( Ho = 0.70, He = 0.81) (Chang et al., 2009) and 37 di‐ and tri‐nucleotide repeat SSRs ( Na = 13.73, Ho = 0.739, He = 0.807, PIC = 0.771) in T. japonicus (Liang et al., 2019) and were higher than those for eight di‐nucleotide repeat SSRs in Trachurus murphyi ( Na = 10.88, Ho = 0.709, He = 0.786) (Canales‐Aguirre et al, 2010) and 28 di‐ and tri‐nucleotide repeat SSRs in Lepturacanthus savala ( Na = 9.11, Ho = 0.634, PIC = 0.670) (Zhang et al., 2018). Our results showed that the developed polynucleotide‐repeat SSRs in the present study exhibited moderate to relatively high genetic diversity in T. japonicus .…”

Section: Discussionmentioning

confidence: 99%

Development and characterization of 33 polymorphic microsatellite markers in Trachurus japonicus by SLAF‐seq technology

Niu

Zhai

et al. 2020

J Appl Ichthyol

View full text Add to dashboard Cite

Trachurus japonicus is an economically important fish in the northwestern Pacific Ocean. However, its resources have declined seriously and there is an urgent need for a wide‐range of investigations of the existing genetic resources. This requires a large number of diverse molecular markers with high discriminating power. In this study, we identified 43,264 perfect SSRs in T. japonicus genome using SLAF‐seq technology. Of these, we randomly selected 106 SSRs (tri‐nucleotide to hexa‐nucleotide) to test for polymorphism. Eventually, we successfully developed a total of 33 loci including 8 tri‐nucleotide and 25 long repeat motifs (tetra‐nucleotide to hexa‐nucleotide). The number of alleles (Na) of these loci ranged from 4 to 24 (mean 12.6). The observed heterozygosity (Ho) and expected heterozygosity (He) varied from 0.258 to 0.969 (mean 0.723) and from 0.452 to 0.962 (mean 0.827), respectively. All loci except TJ6‐7 were highly informative (PIC > 0.5). These results showed that the shortlisted 33 loci exhibited moderate to relatively high genetic diversity, of which 18 were regarded as highly polymorphic and well‐resolved. In summary, these diverse and potential microsatellites detected in our study provide substantial genetic basis for the screening of polymorphic SSR markers of T. japonicus and also provide a powerful tool to perform further studies on the genetic resource assessment and conservation of T. japonicus.

show abstract

Isolation and characterization of microsatellite loci for the jack mackerel (Trachurus murphyi Nichols, 1920)

Cited by 8 publications

References 3 publications

Genetic analysis provides insights into species distribution and population structure in East Atlantic horse mackerel (Trachurus trachurus and T. capensis)

Genetic analysis provides insights into species distribution and population structure in East Atlantic horse mackerel (Trachurus trachurus and T. capensis)

Genetic divergence in Trachurus indicus (Nekrasov, 1966) and Decapterus maruadsi (Temminck & Schlegel, 1843) , Family: Carangidae dwelling the Gulf of Suez, Red Sea

Development and characterization of 33 polymorphic microsatellite markers in Trachurus japonicus by SLAF‐seq technology

Contact Info

Product

Resources

About