Isolation and characterization of microsatellite loci in the dark bush cricket, <i>Pholidoptera griseoaptera</i> (Tettigoniidae)

Arens, Paul; Wernke-Lenting, J. H.; Diekötter, Tim; Rothenbühler, C.; Speelmans, Marjan; Hendrickx, Frederik; Smulders, M.J.M.

doi:10.1111/j.1471-8286.2005.00944.x

Cited by 6 publications

(7 citation statements)

References 4 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Also note that primer pair WPG1‐27 amplifies two microsatellite loci as described in Arens et al . () meaning that samples were genotyped at a total of seven microsatellite loci. Microsatellites were amplified with the Qiagen Multiplex PCR kit following the manufacturer's instructions.…”

Section: Methodsmentioning

confidence: 99%

“…Note the same dye colour was used for WPG10-1 and WPG1-28, and WPG2-30 and WPG8-2 as these can easily be distinguished as they have different size ranges. Also note that primer pair WPG1-27 amplifies two microsatellite loci as described in Arens et al (2005) meaning that samples were genotyped at a total of seven microsatellite loci. Microsatellites were amplified with the Qiagen Multiplex PCR kit following the manufacturer's instructions.…”

Section: Microsatellite Analysismentioning

confidence: 99%

See 1 more Smart Citation

Paternity analysis of wild‐caught females shows that sperm package size and placement influence fertilization success in the bushcricket Pholidoptera griseoaptera

et al. 2017

View full text Add to dashboard Cite

In species where females store sperm, males may try to influence paternity by the strategic placement of sperm within the female's sperm storage organ. Sperm may be mixed or layered in storage organs, and this can influence sperm use beyond a 'fair raffle'. In some insects, sperm from different matings is packaged into discrete packets (spermatodoses), which retain their integrity in the female's sperm storage organ (spermatheca), but little is known about how these may influence patterns of sperm use under natural mating conditions in wild populations. We examined the effect of the size and position of spermatodoses within the spermatheca and number of competing ejaculates on sperm use in female dark bushcrickets (Pholidoptera griseoaptera) that had mated under unmanipulated field conditions. Females were collected near the end of the mating season, and seven hypervariable microsatellite loci were used to assign paternity of eggs laid in the laboratory. Females contained a median of three spermatodoses (range 1-6), and only six of the 36 females contained more than one spermatodose of the same genotype. Both the size and relative placement of the spermatodoses within the spermatheca had a significant effect on paternity, with a bias against smaller spermatodoses and those further from the single entrance/exit of the spermatheca. A higher number of competing males reduced the chances of siring offspring for each male. Hence, both spermatodose size and relative placement in the spermatheca influence paternity success.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Microsatellite Analysismentioning

confidence: 99%

Paternity analysis of wild‐caught females shows that sperm package size and placement influence fertilization success in the bushcricket Pholidoptera griseoaptera

et al. 2017

View full text Add to dashboard Cite

show abstract

“…Individual legs were immediately put in 95% ethanol and stored until processing. Altogether, 220 individuals of M. roeselii were genotyped at six microsatellite loci: MR2‐16, MR2‐42, MR3‐12, MR3‐24 (redesigned reverse primer: 5′‐CAAAGCAATAATCGTTGACCTTC‐3′), MR3‐34, MR3‐44 (Holzhauer & Wolff 2005) and 357 individuals of P. griseoaptera were genotyped at eight microsatellite loci: WPG1‐28, WPG2‐15, WPG2‐16, WPG2‐39, WPG7‐11, WPG8‐2, WPG9‐1, WPG10‐1 (Arens et al. 2005).…”

Section: Methodsmentioning

confidence: 99%

Differential threshold effects of habitat fragmentation on gene flow in two widespread species of bush crickets

et al. 2010

View full text Add to dashboard Cite

Effects of habitat fragmentation on genetic diversity vary among species. This may be attributed to the interacting effects of species traits and landscape structure. While widely distributed and abundant species are often considered less susceptible to fragmentation, this may be different if they are small sized and show limited dispersal. Under intensive land use, habitat fragmentation may reach thresholds at which gene flow among populations of small-sized and dispersal-limited species becomes disrupted. Here, we studied the genetic diversity of two abundant and widespread bush crickets along a gradient of habitat fragmentation in an agricultural landscape. We applied traditional (G(ST), θ) and recently developed (G'ST', D) estimators of genetic differentiation on microsatellite data from each of twelve populations of the grassland species Metrioptera roeselii and the forest-edge species Pholidoptera griseoaptera to identify thresholds of habitat fragmentation below which genetic population structure is affected. Whereas the grassland species exhibited a uniform genetic structuring (G(ST) = 0.020-0.033; D = 0.085-0.149) along the whole fragmentation gradient, the forest-edge species' genetic differentiation increased significantly from D < 0.063 (G(ST) < 0.018) to D = 0.166 (G(ST) = 0.074), once the amount of suitable habitat dropped below a threshold of 20% and its proximity decreased substantially at the landscape scale. The influence of fragmentation on genetic differentiation was qualitatively unaffected by the choice of estimators of genetic differentiation but quantitatively underestimated by the traditional estimators. These results indicate that even for widespread species in modern agricultural landscapes fragmentation thresholds exist at which gene flow among suitable habitat patches becomes restricted.

show abstract

“…DNA extraction was conducted according to the so-called salting-out protocol (Aljanabi & Martinez, 1997) modified by added RNaseA (Hornett & Wheat, 2012). Six polymorphic microsatellite loci were used for genotyping the material (WPG2-16, WPG9-1, WPG1-28, WPG2-15, WPG2-39, WPG7-11; Arens et al, 2005) according to multiplex PCR protocol (Kaňuch et al, 2012). For DNA template amplification, we added either 1 μl of DNA (20-40 ng/ μl) from muscle tissue or 3 μl of DNA (5-10 ng/μl) from spermatodoses into the PCR mastermix.…”

Section: Genotyping and Relatednessmentioning

confidence: 99%

Size‐dependent mating pattern in a nuptial gift‐giving insect

Dorková

Naďo

Jarčuška

et al. 2018

Ecology and Evolution

View full text Add to dashboard Cite

The reproductive interests of females and males often diverge in terms of the number of mating partners, an individual’s phenotype, origin, genes, and parental investment. This conflict may lead to a variety of sex‐specific adaptations and also affect mate choice in both sexes. We conducted an experiment with the bush‐cricket Pholidoptera griseoaptera (Orthoptera, Tettigoniidae), a species in which females receive direct nutritional benefits during mating. Mated individuals could be assigned due to the genotype of male spermatodoses, which are stored in the female’s spermatheca. After 3 weeks of possible copulations in established mating groups which were random replications with four females and males we did not find consistent assortative mating preference regarding to body size of mates. However, our results showed that the frequency of within‐pair copulations (192 analyzed mating events in 128 possible pairwise combinations) was positively associated with the body size of both mated individuals with significant interaction between sexes (having one mate very large, association between body size and the number of copulations has weaken). Larger individuals also showed a higher degree of polygamy. This suggests that body size of this nuptial gift‐giving insect species is an important sexual trait according to which both sexes choose their optimal mating partner.

show abstract

Isolation and characterization of microsatellite loci in the dark bush cricket, Pholidoptera griseoaptera (Tettigoniidae)

Cited by 6 publications

References 4 publications

Paternity analysis of wild‐caught females shows that sperm package size and placement influence fertilization success in the bushcricket Pholidoptera griseoaptera

Paternity analysis of wild‐caught females shows that sperm package size and placement influence fertilization success in the bushcricket Pholidoptera griseoaptera

Differential threshold effects of habitat fragmentation on gene flow in two widespread species of bush crickets

Size‐dependent mating pattern in a nuptial gift‐giving insect

Contact Info

Product

Resources

About