Isolation and identification of Pandoraea spp. From bronchoalveolar lavage of cystic fibrosis patients in Iran

Abstract

Background Pandoraea species are gram negative, motile, non-spore forming, rod shaped and oxidase positive, obligate aerobes bacteria, and have one polar flagellum. Most of Pandoraea species are associated with lung infections in cystic fibrosis patients. Cystic fibrosis is the most prevalent autosomal recessive hereditary disease in the world that affects various organs of the body. The main important cause of death in these patients is lung involvement. This study was conducted to isolate and identify Pandoraea bacterium from bronchoalveolar lavage and sputum samples of cystic fibrosis patients in Shiraz, Iran. Methods In this research 31 samples of bronchoalveolar lavage and sputum were examined by culture and PCR method. Then confirmed isolates were evaluated for susceptibility to different antibiotics and ability to produce biofilm. Results The results of this study after cultivation, purification and DNA extraction led to the isolation of 4 Pandoraea bacterium by PCR using specific primers. Antibiotic susceptibility test were indicated all isolates were resistant to gentamicin, amikacin and imipenem and susceptible to ciprofloxacin, trimethoprim-sulfumethoxazole, piperacillin and tetracycline. Ability to create biofilm was indicated by some of Pandoraea isolates. According to findings of this study, ability to synthesis biofilm by Pandoraea isolates and resistance to some antibiotics are very important. Conclusions Our study notes the role of P . pnomenusa as an emerging pathogen that can cause chronic lung colonization in CF patients. Identification tools need to be accurate and must be based on molecular techniques. Also our findings should raise awareness about antibiotic resistance in cystic fibrosis patients in Iran and ability of including bacterial agents to produce biofilm is an alarm for public health. Thus clinicians should exercise caution about finding of clinical relevance of this pathogen to the infection and prescribing antibiotics, especially in cases of children infections.

Citizen-science based study of the oral microbiome in Cystic fibrosis and matched controls reveals major differences in diversity and abundance of bacterial and fungal species

“…Our results provide further evidence for the relationship between the microbiota of the oral cavity and the lower respiratory tract and suggest a potential reservoir function of the oral microbiome [10][11][12][13]. We found a number of organisms that have been associated with lung infections in CF at higher abundance and prevalence in the oral rinse samples of CF individuals as compared to matched controls (Table 1), including the bacterial genera Chryseobacterium [58][59][60], Microbacterium [61,62], Brevundimonas [60,63,64], Stenotrophomonas [19,21,[65][66][67], Streptococcus [21,[68][69][70][71], Rothia [68,71,72], Staphylococcus [21,65,68,73], Delftia [60,64,[74][75][76], Comamonas [19,59,64,76], Scardovia [64,76,77], Mobiluncus [76,78], Sphingobacterium [60,…”

Pandoraea pnomenusa Superinfection in a Patient with SARS-CoV-2 Pneumonia: First Case in the Literature

“…Since phenotypic identification is not reliable, molecular techniques were applied using MALDI-TOF MS with the Microflex LT mass spectrometer with the FlexControl 3.0 and MALDI BioTyper 2.0 and 3.0 software programs, identifying the isolate as P. pnomenusa with values indicating secure genus identification and probable species identification. Subsequently, identification was performed with PCR and sequencing of 16S rRNA [ 12 , 13 ] using the primers: pnoF and pnoR with sequences (5′-3′) “CAGTGGGGAATTTTGGACAATGGGCGA” and “CGAGCACTCCCACCTCTCAGCAGGA”, respectively, specifically designed for the detection of P. pnomenusa with a product of 673 bp [ 1 , 14 ]. Antibiotic susceptibility testing was performed using antimicrobials that are presumably effective against this microorganism, namely, ciprofloxacin and co-trimoxazole.…”

Prosthetic aortic valve dehiscence following infective endocarditis by a rare bacterium – Pandoraea pnomenusa

“…They are resistant to most of the antimicrobials agents such as aminoglycosides, beta-lactams, quinolones, and have variable sensitivity to piperacillin-tazobactam, tetracycline, and trimethoprimsulfamethoxazole. They produce a biofilm layer which helps for bacterial persistence and antibiotic resistance [5] . The portal of entry for this pathogen was unknown in the index case.…”