Isolation and molecular analysis of genes Stpk-V2 and Stpk-V3 homologous to powdery mildew resistance gene Stpk-V in a Dasypyrum villosum accession and its derivatives

Abstract

Wheat-Dasypyrum villosum translocated chromosomes T6V#2S•6AL and T6V#4S•6DL are known to confer excellent resistance to wheat powdery mildew (PM). However, it is difficult to distinguish the two sources of PM resistance genes through multi-pathotype testing because to date no virulence for them has been found. To reveal the relationship between the PM resistance genes from the two translocations, the sequence of the Stpk-V gene, a key member of powdery mildew resistance locus Pm21, was used as a reference to isolate homologous genes from a D. villosum accession No.1026 and its derivatives 6V#4(6D) disomic substitution (DS) line RW15 and T6V#4S•6DL translocation line Pm97033. Two genes Stpk-V2 and Stpk-V3 were cloned from No.1026. Sequence alignment showed that Stpk-V2 and Stpk-V3 shared 98.2 % and 96.2 % of their DNA and 99.3 % and 100 % of their amino acids in identity with Stpk-V. Compared with Stpk-V, a 22-bp direct sequence repeat and a miniature inverted-repeat transposable element (MITE) were found in the intron 4 of Stpk-V2 and Stpk-V3, respectively. However, Stpk-V2 was not present in DS line RW15 and translocation line Pm97033 based on the PCR result, indicating that Stpk-V2 did not contribute to the PM resistance of RW15 and Pm97033. In the promoter region, a 78-bp insertion was found not only in Stpk-V2 and Stpk-V3, but also in its orthologous gene Stpk-A of wheat. In addition, there was a 17 bp/8 bp deletion/insertion in the putative promoter of Stpk-V3 in comparison with that of Stpk-V/Stpk-V2. Real-time quantitative RT-PCR analysis indicated that the expression levels of Stpk-V and Stpk-V3 genes in the translocation lines were induced by the pathogen, but Stpk-V had a higher expression level than Stpk-V3 at 12 h after inoculation with Bgt. The diversity of Stpk-V gene will help to explore new resistance genes to PM in D. villosum for wheat breeding.

Genetic behavior of Triticum aestivum–Dasypyrum villosum translocation chromosomes T6V#4S·6DL and T6V#2S·6AL carrying powdery mildew resistance

“…Previously, we isolated a Stpk-V homologous gene, Stpk-V3, in T6V#4S•6DL translocation line Pm97033, and found polymorphism between the two homologous genes (in both intron and regulatory (5´-UTR) regions). We further confirmed that the transcript levels of the two genes differed following challenge with the PM pathogen (Zhang et al 2012;Lin et al 2013). A recently developed anonymous marker, MBH1, can distinguish Pm21 and PmV loci on 6V#2S and 6V#4S unambiguous, respectively (Bie et al 2015).…”

“…It is inferred that structural difference in chromatin could affect the pairing frequency of alien homologous chromosomes in wheat background. Although 6V#2S and 6V#4S were previously identified to confer differing responses to some diseases and to have polymorphisms detectable by molecular markers (Li et al 2002(Li et al , 2005aZhang et al 2012;Lin et al 2013;Bie et al 2015), their pairing behavior is totally unknown till now. In present study, we found in the PMCs of the F 1 hybrid progeny from a cross of translocation lines 6V#2S•6AL and 6V#4S•6DL that the two translocated chromosomes paired with their corresponding homologous wheat chromosomes (6A and 6D, respectively) via their long arms, forming two rod bivalents in most cases.…”

Comparative analysis of genetic effects of wheat‐Dasypyrum villosum translocations T6V#2S·6AL and T6V#4S·6DL

“…Although each of both T6V#2S·6AL and T6V#4S·6DL translocations contains a short arm of D. villosum chromosome 6V, broad polymorphisms have been revealed between 6V#2S and 6V#4S chromosomes, at both phenotypic and genotypic levels. Divergence between 6V#2S and 6V#4S at DNA sequential level has been revealed in previous studies (Bie, Zhao, Zhu, et al, ; Li, Chen, Shi, et al, ; Li et al, ; Lin et al, ; Liu, Li, Wang, Ye, & Lin, ; Zhang et al, ). Different response patterns to wheat streak mosaic virus, wheat cur l mite, and powdery mildew were also observed in various wheat‐ Haynaldia villosa 6V or 6VS lines (Chen, Shang, Steven, & Jpaul, ; Li et al, ).…”

“…The marker 6S‐19 was developed based on an expressed sequence tag (EST) located at the distal regions of chromosomes of wheat group 6 (Bie, Zhao, Jiang, et al, ), which can distinguish distal regions of D. villosum 6V#2S and 6V#4S. CINAU15m2, a proximal marker to Pm21 , developed based on the sequences of Stpk‐V alleles (Cao et al, ; Lin et al, ) in this study, can also distinguish the corresponding alleles on 6V#2S and 6V#4S. The primer pairs of MBH1 (F: GCCATTATAGTCAAGAGTGCACTAGCTGT; R: AGCTCCTCTCGTTCTCCAATGCT), 6S‐19 (F: CCAGTCGGAGAGGATCTCAA; R: TGGGCCTCTTGATCTTGACT) and CINAU15m2 (F: GTGCGCTGCATGTTTACTACTCAT; R: AAGTAATGCCGACAGTTTATCACAAT) were synthesized at Genebase Biotechnology Co.…”

Development and Verification of Wheat Germplasm Containing Pm21

“…The accumulation of Pm21 gene in a susceptible variety is a substantial aspect in both experimental breeding and commercial cultivation. Several studies were reported on the efforts to develop and exploit molecular markers to tag Pm21 (Qi et al, 1996;Liu et al, 1999;Cao et al, 2006;Song et al, 2009;Cao et al, 2011;He et al, 2013;Bie et al, 2015) and PmV (Lin et al, 2013).…”