Isolation, Molecular and Biochemical Identification of Paraoxon-Metabolizing Pseudomonas Species

Abstract

Seven soil borne bacterial isolates were collected from locations throughout the Houston metropolitan area. All isolates proved capable of degrading the pesticide paraoxon to p-nitrophenol in carbon limited media and showed a high degree of tolerance to an environment exposed to increasing concentrations of the pesticide. A combination of 16S rRNA sequencing and fatty acid methyl ester (FAME) analysis was used to identify the unknown bacterial species. Universal bacterial primers were used for 16S rRNA analysis to tentatively identify all seven isolates as species belonging to the genus Pseudomonas. Sequencing results coupled with FAME analysis resolved the species identity of the seven isolates as either Pseudomonas aeruginosa or Pseudomonas putida. The results of this study demonstrate that a combination of molecular and biochemical analysis provide sufficient resolution to identify paraoxon degrading microbial populations.

Biodegradation of Organophosphorus Pesticide (Malathion) by Bacillus sp. FYM31 Isolated from Agriculture Drainage Water

“…Equal volumes of acetonitrile and culture supernatant were mixed, and then the mixture Malathion degrading gene of the selected bacterial strain was detected by the presence of organophosphorus hydrolase encode as (opd) gene using specific primers, forward primer (opd F169) sequence is 5'CGCGGTCCTATCACAATCTC3' and reverse primer (opd R169) sequence is 5'CTTCTAGACCAATCGCACTG3' [33] with using1.5 μl of standard 1kb DNA ladder (Thermo Scientific, USA) were loaded in 1% agarose gel. Digital images were obtained for PCR products bands using Bio-Rad's Gel Doc XR+ system.…”

Isolation and evaluation of potent Pseudomonas species for bioremediation of phorate in amended soil

“…Different species of Pseudomonas have been found to be an effective biodegrader of different organophophorus insecticides (Bano and Mussarrat, 2003;Lei et al, 2005;Madhuri and Rangaswamy, 2009;Malghani et al, 2009;Rani and Juwarkar, 2012). Iyer et al (2011) reported the biodegradation of phorate (Ortiz-Hernandez et al, 2003;Serdar et al, 1982). To date, only one Pseudomonas sp.…”