IUGR with infantile overnutrition programs an insulin-resistant phenotype through DNA methylation of peroxisome proliferator–activated receptor-γ coactivator-1α in rats

Abstract

Background: Intrauterine growth restriction (IUGR) followed by postnatal accelerated growth (CG-IUGR) is associated with long-term adverse metabolic consequences, and an involvement of epigenetic dysregulation has been implicated. Peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) is a key orchestrator in energy homeostasis. We hypothesized that CG-IUGR programed an insulin-resistant phenotype through the alteration in DNA methylation and transcriptional activity of PGC-1α. Methods: A CG-IUGR rat model was adopted using maternal gestational nutritional restriction followed by infantile overnutrition achieved by reducing the litter size. The DNA methylation was determined by pyrosequencing. The mRNA expression and mitochondrial content were assessed by realtime PCR. The insulin-signaling protein expression was evaluated by western blotting. results: Compared with controls, the CG-IUGR rats showed an increase in the DNA methylation of specific CpG sites in PGC-1α, and a decrease in the transcriptional activity of PGC-1α, mitochondrial content, protein level of PI3K and phosphorylated-Akt2 in liver and muscle tissues. The methylation of specific CpG sites in PGC-1α was positively correlated with fasting insulin concentration. conclusion: IUGR followed by infantile overnutrition programs an insulin-resistant phenotype, possibly through the alteration in DNA methylation and transcriptional activity of PGC-1α. The genetic and epigenetic modifications of PGC-1α provide a potential mechanism linking early-life nutrition insult to long-term metabolic disease susceptibilities.

Placental DNA methylation of peroxisome-proliferator-activated receptor-γ co-activator-1α promoter is associated with maternal gestational glucose level

“…The alterations in placental DNA methylation can disturb placental function which may contribute to disease susceptibility in later life [22]. Furthermore, PPARGC1A methylation alterations have been demonstrated in diabetes [27,28] and NAFLD [29] patients as well as low-birthweight individuals [30] and IUGR (intrauterine growth restriction) rats [55]. It is likely that the placental DNA methylation adaptation of the PPARGC1A promoter in response to GDM is a surrogate marker for, or responsible for, future metabolic diseases in offspring such as Type 2 diabetes and NAFLD [51,52].…”

Increased Cord Blood Betatrophin Levels in the Offspring of Mothers with Gestational Diabetes

“…The mitochondria content was presented as the mitochondrial/nuclear DNA ratio (mtDNA/nDNA) and determined as previously described [ 33 – 35 ]. A fragment located in MT-ND1 (NC_012920.1) was amplified with the primers forward: TGGGCCATACGGTAGTATTTAGTTGG and reverse: TTACCCTATAGCACCCCCTCTAC for mitochondrial DNA; while a fragment in HBB (NG_000007.3) sequence were amplified with the primers forward: TTTTCCCACCCTTAGGCTG and reverse: CTCACTCAGTGTGGCAAAG for nuclear DNA [ 35 ].…”

Advanced aging phenotype is revealed by epigenetic modifications in rat liver after in utero malnutrition

“…Targeting replicative cells holds greater potential to propagate those epigenetic changes into later life, thereby acting as an epigenetic memory of early life conditions. The effect of adverse maternal diet on locus‐specific differential methylation has been demonstrated in liver (Dudley et al ., 2011; Xie et al ., 2015), but a genomewide approach specific to liver is limited. However, our group interrogated genomewide methylation changes associated with intrauterine growth restriction in the pancreatic islets of male rat offspring and found methylation changes occurring in intergenic regions of pathways regulating β‐cell function (Thompson et al ., 2010a).…”