2020
DOI: 10.30597/mkmi.v16i1.9050
|View full text |Cite
|
Sign up to set email alerts
|

Karakterisasi DNA Mikrobiota Usus Bayi pada Persalinan Normal yang diberi ASI dan Susu Formula

Abstract: Air Susu Ibu (ASI) merupakan sumber nutrisi paling baik karena mengandung berbagai senyawa sehat dan dapat menjaga serta meningkatkan sistem kekebalan tubuh bayi. Terkait peran dan fungsi ASI pada sistem imun, beberapa penelitian tentang mikrobiota usus juga membuktikan peran pentingnya dalam perkembangan sistem imun tersebut. Penelitian ini bertujuan mengkarakterisasi DNA mikrobiota usus bayi yang dilahirkan dengan persalinan normal yang diberi ASI dan Susu Formula (Sufor). Penelitian ini menggunakan desain c… Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
2
1
1
1

Citation Types

0
5
0
1

Year Published

2020
2020
2023
2023

Publication Types

Select...
5
1

Relationship

3
3

Authors

Journals

citations
Cited by 6 publications
(6 citation statements)
references
References 11 publications
0
5
0
1
Order By: Relevance
“…Genomic DNA was extracted from symbiont bacterial isolates using the DNAzol® reagent (Thermo Fisher Scientific, Waltham, MS, USA) according to the manufacturer's instructions with some modifications (Kamaruddin et al 2014). Total DNA of extracted symbionts was amplified with universal primers of 16S rRNA gene with forward sequence was 5'CCAGCAGCCGCGGTAATACG 3´ attached to the nucleotide base of 518-537, and reverse sequence was 5´ATCGG(C/T)TACCTTGTTACGACTTC 3´ attached to the nucleotide base of 1513-1491 (Kamaruddin et al 2020;Marzuki et al 2020;Minarti et al 2020). The PCRs were performed in a final volume of 20 μl using DreamTag buffer (Fermentas, MA), approximately 1µg of genomic DNA as templates, each primer at 0.2µM, each deoxynucleoside triphosphate (dNTP) at 2.5 mM and 2.5 mM enzyme under the following condition: a denaturation step of 94°C for 1 min followed by 30 cycles of 95˚C for 5 min, annealing at 54°C for 1 min 20 seconds, and extension at 72°C for 2 min.…”
Section: Dna Extraction Pcr and Sequencing Analysismentioning
confidence: 99%
“…Genomic DNA was extracted from symbiont bacterial isolates using the DNAzol® reagent (Thermo Fisher Scientific, Waltham, MS, USA) according to the manufacturer's instructions with some modifications (Kamaruddin et al 2014). Total DNA of extracted symbionts was amplified with universal primers of 16S rRNA gene with forward sequence was 5'CCAGCAGCCGCGGTAATACG 3´ attached to the nucleotide base of 518-537, and reverse sequence was 5´ATCGG(C/T)TACCTTGTTACGACTTC 3´ attached to the nucleotide base of 1513-1491 (Kamaruddin et al 2020;Marzuki et al 2020;Minarti et al 2020). The PCRs were performed in a final volume of 20 μl using DreamTag buffer (Fermentas, MA), approximately 1µg of genomic DNA as templates, each primer at 0.2µM, each deoxynucleoside triphosphate (dNTP) at 2.5 mM and 2.5 mM enzyme under the following condition: a denaturation step of 94°C for 1 min followed by 30 cycles of 95˚C for 5 min, annealing at 54°C for 1 min 20 seconds, and extension at 72°C for 2 min.…”
Section: Dna Extraction Pcr and Sequencing Analysismentioning
confidence: 99%
“…Pada urutan genom ke-614, terjadi perubahan dari asam aspartik (D) menjadi glycin (G). Jika mutasi terjadi lebih luas pada protein spike khususnya pada subunit Spike 1, dipastikan dapat mempengaruhi afinitas domain pengikatan reseptor terhadap reseptor Angiotensin Converting-Enzyme 2 (ACE2) (Kamaruddin et al, 2020).…”
Section: Pendahuluanunclassified
“…The sponge-symbiotic bacteria Bacillus cohnii strains DSM 6307 (BS) and Pseudomonas stutzeri RCH2 (PS) were collected from the previous study (Marzuki et al 2021b) and have been molecularly identified using a modified technique of (Kamaruddin et al 2014;Kamaruddin et al 2020;Minarti et al 2020). These two bacteria were isolated from the sponge Niphates sp., and Clathria (Thalysias) reinwardti from around Kodingareng Keke Island (119°17'19.399" E and 5°6'21.423"S), which is part of the Spermonde Archipelago area in Makassar, South Sulawesi.…”
Section: Collection Of Marine Sponge-symbiotic Bacteriamentioning
confidence: 99%