Llama-Derived Single Domain Antibodies to Build Multivalent, Superpotent and Broadened Neutralizing Anti-Viral Molecules

Abstract

For efficient prevention of viral infections and cross protection, simultaneous targeting of multiple viral epitopes is a powerful strategy. Llama heavy chain antibody fragments (VHH) against the trimeric envelope proteins of Respiratory Syncytial Virus (Fusion protein), Rabies virus (Glycoprotein) and H5N1 Influenza (Hemagglutinin 5) were selected from llama derived immune libraries by phage display. Neutralizing VHH recognizing different epitopes in the receptor binding sites on the spikes with affinities in the low nanomolar range were identified for all the three viruses by viral neutralization assays. By fusion of VHH with variable linker lengths, multimeric constructs were made that improved neutralization potencies up to 4,000-fold for RSV, 1,500-fold for Rabies virus and 75-fold for Influenza H5N1. The potencies of the VHH constructs were similar or better than best performing monoclonal antibodies. The cross protection capacity against different viral strains was also improved for all three viruses, both by multivalent (two or three identical VHH) and biparatopic (two different VHH) constructs. By combining a VHH neutralizing RSV subtype A, but not subtype B with a poorly neutralizing VHH with high affinity for subtype B, a biparatopic construct was made with low nanomolar neutralizing potency against both subtypes. Trivalent anti-H5N1 VHH neutralized both Influenza H5N1 clade1 and 2 in a pseudotype assay and was very potent in neutralizing the NIBRG-14 Influenza H5N1 strain with IC50 of 9 picomolar. Bivalent and biparatopic constructs against Rabies virus cross neutralized both 10 different Genotype 1 strains and Genotype 5.The results show that multimerization of VHH fragments targeting multiple epitopes on a viral trimeric spike protein is a powerful tool for anti-viral therapy to achieve “best-in-class” and broader neutralization capacity.

Straightforward Selection of Broadly Neutralizing Single-Domain Antibodies Targeting the Conserved CD4 and Coreceptor Binding Sites of HIV-1 gp120

“…Hultberg and collaborators have recently demonstrated the possibility of significantly increasing (up to 4,000-fold) the neutralization potency of sdAbs directed against the trimeric Env proteins of several viruses (H5N1 influenza virus, rabies virus, and Rous sarcoma virus) by designing bivalent and trivalent constructs of neutralizing sdAbs (22). This is probably explained by an avidity effect, multivalent sdAbs being able to bind several protomers of the single trimeric Env.…”

“…To create the remaining bivalent-protein genes (JM3x2, JM3x3, JM3x4, JM3x5, JM5x2, JM5x3, JM5x4, and JM5x5), PCR amplifications were performed using primers Trim1For (CTCGCGGCCCAGCCGGCC ATGGCCGAGGTGCAGCTG) and Trim1Rev (CCGCTGCCACCTCCC CCCAGGCCTGAGGAGACAGTGACCTG) to amplify the JM3 and JM5 genes, which were substituted for the first sdAb gene of previous constructs using the InFusion system (the cloning scheme is illustrated in Fig. S1 in the supplemental material) (22). All constructs were checked by sequencing.…”

Neutralisation of HIV-1 cell-cell spread by human and llama antibodies

“…By reconstituting the heavy-chain only J3 into an antibody format to produce J3-Fc, we demonstrated here that inhibition of cell-cell infection by J3 was not simply a product of its smaller size since J3-Fc is six times larger than J3 but was consistently better able to neutralise cell-associated and cell-free virus infection. Previous studies have shown bivalent VHH have increased affinity for antigen and potency of neutralisation [46,47]. This increase in potency is therefore likely due to avidity effects conferred by the bivalent nature of J3-Fc since the J3 HCAb was more potently neutralising of cell-free virus when compared to the VHH alone on a molar scale against eleven viruses from subtypes A, B, C and CRF AG and BC including transmitter/founder viruses.…”

Single Domain Antibodies and Bioengineering Drugs on Their Basis: New Opportunities for Diagnostics and Therapy

“…Поливалентные наноантитела, состоящие из VHH-доменов, могут стать мощным инстру-ментом для терапии резистентных вирусных ин-фекций, обусловленных высокой вариабельно-стью вируса, в том числе ВИЧ, вирусов гриппа, гепатита В и некоторых других [12,67].…”

“…Примером могут по-служить наноантитела лам, иммунизированных инактивированной антирабической вакциной Merieux HCDV (генотип 1). При этом мультиме-ризация этих моновалентных наноантител спо-собна многократно (на 3-4 порядка) увеличивать их нейтрализующие свойства [67].…”