Localization and developmental fate of ovoperoxidase and proteoliaisin, two proteins involved in fertilization envelope assembly

Somers, Cynthia E.; Battaglia, David E.; Shapiro, Bennett M.

doi:10.1016/s0012-1606(89)80054-5

Cited by 44 publications

(25 citation statements)

References 25 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Of the 12 different proteins secreted by the cortical granules (Wessel et al, 2001), the six major proteins visible by Coomassie staining are directly incorporated into the fertilization envelope . Five genes encode these cortical granule proteins, including proteoliaisin (Somers et al, 1989;Somers and Shapiro, 1991), sfe1 (Wessel et al, 2000;Laidlaw and Wessel, 1994), sfe9 (Wessel, 1995;Laidlaw and Wessel, 1994), rendezvin (Wong and Wessel, 2006b) [see Box 1 below], and the enzyme ovoperoxidase (LaFleur et al, 1998;Nomura and Suzuki, 1995;Nomura et al, 1999). These six proteins rapidly self-assemble within the vitelline layer scaffold to form the fertilization envelope (Fig.…”

Section: Construction Of the Fertilization Envelopementioning

confidence: 99%

“…This myeloperoxidaselike family of enzymes is specifically transcribed in oocytes, and packaged into cortical granules (LaFleur et al, 1998;Nomura and Suzuki, 1995). When released from the cortical granule lumen, ovoperoxidase is drawn away from the egg surface by the tethering protein, proteoliaisin, that keeps the enzyme associated with the elevating vitelline layer, thereby restricting its cross-linking activity to the ECM undergoing modification (Somers et al, 1989;Mozingo et al, 1994).…”

Section: Construction Of the Fertilization Envelopementioning

confidence: 99%

See 1 more Smart Citation

Renovation of the egg extracellular matrix at fertilization

Wong¹,

Wessel²

2008

Int. J. Dev. Biol.

View full text Add to dashboard Cite

Extracellular matrices are essential for cell survival and function. This is especially relevant for eggs, which establish a physical barrier at fertilization to protect a new embryo from additional sperm and pathogens. Formation of an extracellular matrix is most dramatic in sea urchins, in which fertilization was first observed in animals with the "sudden appearance of a perfectly transparent envelope" (A. Derbès, 1847). The process of assembling this extracellular "envelope" has been a topic of intense study ever since. Here we integrate the cellular and molecular events necessary to form this fertilization envelope within the first few minutes of a new embryo's life.

show abstract

Section: Construction Of the Fertilization Envelopementioning

confidence: 99%

Section: Construction Of the Fertilization Envelopementioning

confidence: 99%

Renovation of the egg extracellular matrix at fertilization

Wong¹,

Wessel²

2008

Int. J. Dev. Biol.

View full text Add to dashboard Cite

show abstract

“…(2) Transamidation may tether specific proteins to the fertilization envelope. Ovoperoxidase glutamines, for example, could be covalently bound to proteoliaisin lysines, thereby establishing more permanent association between these two proteins (Somers et al, 1989;Weidman et al, 1985); it is still possible to resolve the two proteins after pharmacological inhibition of ovoperoxidase (Deits et al, 1984;Showman and Foerder, 1979) because transamidation is repressed in the intercast region, where the majority of these proteins reside in the expanded fertilization envelope (Mozingo et al, 1994). Alternatively, (3) crosslinking of intra-enzyme glutamine and lysine residues may positively regulate ovoperoxidase, perhaps locking it in an active state following hysteretic modification (Deits and Shapiro, 1985;Deits and Shapiro, 1986).…”

Section: Research Articlementioning

confidence: 99%

Extracellular matrix modifications at fertilization: regulation of dityrosine crosslinking by transamidation

Wong

Wessel

2009

Development

View full text Add to dashboard Cite

Fertilization is accompanied by the construction of an extracellular matrix that protects the new zygote. In sea urchins, this structure is built from glycoproteins residing at the egg surface and in secretory vesicles at the egg cortex. Four enzymatic activities are required for the transformation of these proteins into the mechanically and chemically resilient fertilization envelope: proteolysis, transamidation, NADPH-dependent oxidation and peroxidation. Here, we identify the Strongylocentrotus purpuratus enzymes responsible for the formation of ε(γ-glutamyl)lysine crosslinks (transamidation). We find that these two transglutaminases are activated by local acidification and act on specific substrates within the fertilization envelope (including ovoperoxidase, rendezvin and SFE9). Surprisingly, these enzymes also regulate dityrosine crosslinking both by direct conjugation of ovoperoxidase and by modulating hydrogen peroxide production. Together, these results emphasize how transglutaminases can coordinate the activities of other enzymes during extracellular matrix transmogrifications. Development 136, 1835Development 136, -1847Development 136, (2009Development 136, ) doi:10.1242 Department of Molecular Biology, Cell Biology, and Biochemistry, Box G-L173, 185 Meeting Street, Brown University, Providence, RI 02912, USA. KEY WORDS: Extracellular matrix, Fertilization, Transamidation, Transglutaminase, Sea urchin*Author for correspondence (e-mail: rhet@brown.edu) Accepted 9 March 2009 DEVELOPMENT MATERIALS AND METHODS AnimalsStrongylocentrotus purpuratus gametes were obtained and handled as previously described . RNA in situ hybridizationAntisense digoxigenin-labeled RNA probes (DIG RNA Labeling Kit (SP6/T7); Roche Diagnostics Corporation, Indianapolis, IN, USA) representing S. purpuratus eTG (nucleotides 1274 to 1802) and nTG (nucleotides -62 to 403) or negative control probe (neomycin phosphotransferase II) were used at 0.1 μg probe/ml to detect native transcript in oocytes according to previously published protocols (ArenasMena et al., 2000). Quantitative PCRReal-time quantitative PCR was conducted on about 0.1 μg-equivalents of total RNA isolated from hand-collected oocytes or eggs (Song et al., 2006). Primers representing the 3Ј-end of each transglutaminase open reading frame were used to amplify products for eTG (199 bp using F=5Ј CACT-GAGGATTTGATGGTTGG with R=5Ј GGTTGCCTGTCTTCTTTGGT) and nTG (169 bp using F=5Ј CCACCGGAGATGAAGACTGA with R=5Ј TTGCCCTTTGAAGGAACATC), and cycle numbers were normalized to ubiquitin (~147 bp using F=5Ј CACAGGCAAGACCATCACAC; R=5Ј GAGAGAGTGCGACCATCCTC). Each PCR reaction was run off of cDNA (TaqMan Reverse Transcription kit; Applied Biosystems, Foster City, CA, USA) using Platinum SBYR Green qPCR SuperMix-UDG with ROX (Invitrogen Corporation, Carlsbad, CA, USA) on a 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Production of polyclonal antiseraAntiserum was raised in rabbits against bacterially overexpressed, recombinant fragments subcloned downstream of ...

show abstract

“…2). Ovoperoxidase is localized within the secretory vesicles, together with equivalent amounts of a 235,000 molecular weight ovoperoxidase-binding protein called proteoliaisin, perhaps as a preexisting complex (8). Ovoperoxidase and proteoliaisin associate in a Ca*+-dependent reaction with a stoichiometry of 1 : 1 and K d = (9).…”

Section: A Fertilization Envelope Assemblymentioning

confidence: 99%