Long noncoding RNA–mediated activation of PROTOR1/PRR5-AKT signaling shunt downstream of PI3K in triple-negative breast cancer

Abstract

The phosphoinositide 3-kinase (PI3K) pathway represents the most hyperactivated oncogenic pathway in triple-negative breast cancer (TNBC), a highly aggressive tumor subtype encompassing ∼15% of breast cancers and which possesses no targeted therapeutics. Despite critical contributions of its signaling arms to disease pathogenesis, PI3K pathway inhibitors have not achieved expected clinical responses in TNBC, owing largely to a still-incomplete understanding of the compensatory cascades that operate downstream of PI3K. Here, we investigated the contributions of long noncoding RNAs (lncRNAs) to PI3K activities in clinical and experimental TNBC and discovered a prominent role for LINC01133 as a PI3K-AKT signaling effector. We found that LINC01133 exerted protumorigenic roles in TNBC and that it governed a previously undescribed mTOR Complex 2 (mTORC2)–dependent pathway that activated AKT in a PI3K-independent manner. Mechanistically, LINC01133 induced the expression of the mTORC2 component PROTOR1/PRR5 by competitively coupling away its negative messenger RNA (mRNA) regulator, the heterogeneous nuclear ribonucleoprotein A2/B1 (hnRNPA2B1). PROTOR1/PRR5 in turn was sufficient and necessary for LINC01133-triggered functions, casting previously unappreciated roles for this Rictor-binding protein in cellular signaling and growth. Notably, LINC01133 antagonism undermined cellular growth, and we show that the LINC01133-PROTOR1/PRR5 pathway was tightly associated with TNBC poor patient survival. Altogether, our findings uncovered a lncRNA-driven signaling shunt that acts as a critical determinant of malignancy downstream of the PI3K pathway and as a potential RNA therapeutic target in clinical TNBC management.

Dissection of FOXO1-Induced LYPLAL1-DT Impeding Triple-Negative Breast Cancer Progression via Mediating hnRNPK/β-Catenin Complex

“…The functions and molecular mechanisms of lncRNAs are primarily ascertained by the subcellular localization [ 36 , 37 ]. For instance, lncRNAs largely localized in the nucleus, like HUMT and NRAD1, monitor the transcription of genes [ 9 , 38 ], while the cytoplasmic lncRNAs generally function as sponges for miRNAs to modulate the expression level of the linked mRNAs, such as ARNILA, CCAT2, and lnc015192 [ 39 – 42 ], along with others participating in the mediation of the cellular signaling pathway [ 8 , 43 – 46 ]. The subcellular fractionation assays and RNA-FISH experiment proved that LYPLAL1-DT was located in both cytoplasm and nucleus of TNBC cells, and the further mechanistic explorations elucidated that LYPLAL1-DT restricted the Wnt/β-catenin signaling pathway by promoting the ubiquitination of β-catenin and subsequently destabilizing its protein rather than regulating its transcription.…”

SP1-Induced Upregulation of LncRNA AFAP1-AS1 Promotes Tumor Progression in Triple-Negative Breast Cancer by Regulating mTOR Pathway

“…For example, LINC01133 was suggested to be downstream of the PI3K pathway and functioned as an upstream regulator of PI3K-AKT. Mechanically, it activated AKT in a PI3K-independent manner and exerted oncogenic activity in TNBC in a mTORC2-dependent pathway, in which LINC01133 induced the expression of PROTOR1/PRR5 (mTORC2 component) by coupling to a negative regulator of PRR5, hnRNPA2B1 [ 44 ]. A small-molecule Comp34 preferentially targeted TNBC and cancer stem cells and inhibited AKT1/mTOR expression by inhibition of lncRNA NUDT3-AS4, which sponged miR-99s to release the mRNA of AKT1/mTOR from miRNA-dependent decay [ 45 ].…”

A new strategy for screening novel functional genes involved in reduction of lipid droplet accumulation

“…Gene expression was analyzed by quantitative reverse transcription‐PCR (RT‐PCR) as previously described 23 . The sequences of the primer sets used in this study were as follows: 36B4 , 24 5′‐TGCATCAGTACCCCATTCTATCA‐3′ and 5′‐AAGGTGTAATCCGTCTCCACAGA‐3′; DGAT1 , 25 5′‐TATTGCGGCCAATGTCTTTGC‐3′ and 5′‐CACTGGAGTGATAGACTCAACCA‐3′; MED6 , 5′‐CTTGGGTTGACAGCTCTTGGA‐3′ and 5′‐GCATGCAAAAGGATGTACTCGAT‐3′; PLIN2 , 26 5′‐GGCTAGACAGGATTGAGGAGAG‐3′ and 5′‐TCACTGCCCCTTTGGTCTTG‐3′; PPFIa1 , 27 5′‐ACCAAAGGACATTCGTGGCT‐3′ and 5′‐AAAGCTGCTCATGCTCCCAA‐3′; PRR5 , 28 5′‐CCTTCACCCATTCCTGCATCC‐3′ and 5′‐AGAGGCGTGTTGTAGCTCTTG‐3′; RAI14 , 29 5′‐CCAGTGCCACCAAACACG‐3′ and 5′‐TTCGGCTGGGCATTTAGAC‐3′; RLIM , 5′‐AGGACAGAGACCTCCAACCA‐3′ and 5′‐ACGCCTAAAACCTCCTCGTT‐3′.…”