&lt;p&gt;Down-Regulation of Hypoxia-Inducible Factor-1α and Downstream Glucose Transporter Protein-1 Gene by β-elemene Enhancing the Radiosensitivity of Lung Adenocarcinoma Transplanted Tumor&lt;/p&gt;

Wu, Wenbo; Hu, Zhonghui; Zhao, Qingtao; Zhang, Xiaopeng; Zhang, Hua; Wang, Huien; Xue, Wenfei; Yu, Lei; Duan, Guochen

doi:10.2147/ott.s275956

Cited by 7 publications

(2 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…QRT‐PCR was carried out with one‐step RT qPCR SYBRGreen Kit (DBI). The primers were purchased form Sangon Biotech and the sequences used were listed as follow 36 , 37 : HAX1‐Forward: ACGCCTCGCTCAATTTCTCA, HAX1‐Reverse: AAGCCAAATTCCTCAGGGGG; HIF‐1α: HIF‐1α‐Forward: 5ʹ‐AGTGTACCCTAACTAGCCG‐3ʹ, HIF‐1α‐Reverse: 5ʹ‐CACAAATCAGCACCAAGC‐3ʹ. 2 −ΔΔCT methods were applied to calculate the mRNA expression levels.…”

Section: Methodsmentioning

confidence: 99%

HAX1 maintains the glioma progression in hypoxia through promoting mitochondrial fission

Lin

Wang

Lin

2021

J Cellular Molecular Medi

View full text Add to dashboard Cite

HCLS1-associated protein X-1 (HAX1), an anti-apoptotic molecular, overexpresses in glioma. However, the role of HAX1 in glioma cell surviving in hypoxic environment remains unclear. Western blotting, qRT-PCR, Transwell assay, TUNEL assay, wounding healing assay, clone formation, tumour xenograft model and immunohistochemical staining were used to investigate the role of HAX1 in glioma. HAX1 regulated by HIF-1α was increased in glioma cells cultured in hypoxia. Silencing of HAX1 could cause an increased apoptosis of glioma cells cultured in hypoxia. Silencing of HAX1 also decreased the proliferation, migration and invasion of glioma cells cultured in hypoxia. Increased mitochondrial fission could prevent glioma cells from the damage induced by HAX1 knockdown in hypoxia. Furthermore, HAX1 was found to regulate glioma cells through phosphorylated AKT/Drp signal pathway. In conclusion, our study suggested that HAX1 promoted survival of glioma cells in hypoxic environment via AKT/Drp signal pathway. Our study also provided a potential therapeutic target for glioma.

show abstract

Section: Methodsmentioning

confidence: 99%

HAX1 maintains the glioma progression in hypoxia through promoting mitochondrial fission

Lin

Wang

Lin

2021

J Cellular Molecular Medi

View full text Add to dashboard Cite

show abstract

“…A decrease in HIF-1α and GLUT1 expression was detected in lung cancer xenografts treated with β-elemene [ 165 ]. The administration of β-elemene sensitizes lung cancer to radiotherapy, demonstrating that β-elemene can improve radiotherapy efficiency by impeding hypoxia-mediated glycolysis.…”

Section: Terpene Phytochemicalsmentioning

confidence: 99%

Anti-Cancer Activity of Phytochemicals Targeting Hypoxia-Inducible Factor-1 Alpha

Yun

Son

Choi

et al. 2021

IJMS

View full text Add to dashboard Cite

Hypoxia-inducible factor-1 alpha (HIF-1α) is overexpressed in cancer, leading to a poor prognosis in patients. Diverse cellular factors are able to regulate HIF-1α expression in hypoxia and even in non-hypoxic conditions, affecting its progression and malignant characteristics by regulating the expression of the HIF-1α target genes that are involved in cell survival, angiogenesis, metabolism, therapeutic resistance, et cetera. Numerous studies have exhibited the anti-cancer effect of HIF-1α inhibition itself and the augmentation of anti-cancer treatment efficacy by interfering with HIF-1α-mediated signaling. The anti-cancer effect of plant-derived phytochemicals has been evaluated, and they have been found to possess significant therapeutic potentials against numerous cancer types. A better understanding of phytochemicals is indispensable for establishing advanced strategies for cancer therapy. This article reviews the anti-cancer effect of phytochemicals in connection with HIF-1α regulation.

show abstract

HIF-1α is an important regulator of IL-8 expression in human bone marrow stromal cells under hypoxic microenvironment

Huang,

You,

Tan

et al. 2023

Protoplasma

View full text Add to dashboard Cite

<p>Down-Regulation of Hypoxia-Inducible Factor-1α and Downstream Glucose Transporter Protein-1 Gene by β-elemene Enhancing the Radiosensitivity of Lung Adenocarcinoma Transplanted Tumor</p>

Cited by 7 publications

References 43 publications

HAX1 maintains the glioma progression in hypoxia through promoting mitochondrial fission

HAX1 maintains the glioma progression in hypoxia through promoting mitochondrial fission

Anti-Cancer Activity of Phytochemicals Targeting Hypoxia-Inducible Factor-1 Alpha

HIF-1α is an important regulator of IL-8 expression in human bone marrow stromal cells under hypoxic microenvironment

Contact Info

Product

Resources

About