<p>Impact of <em>APOE</em> Alleles-by-Diet Interactions on Glycemic and Lipid Features– A Cross-Sectional Study of a Cohort of Type 2 Diabetes Patients from Western Mexico: Implications for Personalized Medicine</p>

Abstract

Purpose To analyze clinically relevant interactions between the apolipoprotein E ( APOE ) ε2, ε3 and ε4 alleles and nutritional factors on glycemic control and lipid levels in a cohort of type 2 diabetes (T2D) patients from western Mexico. Patients and Methods In this cross-sectional study of the cohort of T2D patients, a total of 224 individuals were selected for interaction studies. Clinical and anthropometric data were obtained from pre-designed medical records. Dietary intake was assessed by validated three-day food consumption records. Biochemical measurements were determined by automated methods. APOE genotyping was performed by a real-time allelic discrimination assay. Gene–diet interactions were tested by corrected multiple linear regression analyses, which were adjusted by potential confounding factors such as age, sex, energy intake, BMI and anti-hyperglycemic therapy (Metformin, Glibenclamide or Insulin), and years with T2D. Results Seventy-six percent of patients with T2D were on Metformin therapy. The frequencies of the APOE alleles were ε2 (5.8%), ε3 (74.1%) and ε4 (20.1%). After statistical settings, significant APOE alleles-by-diet interactions in relation to the metabolic profile were found. Interestingly, higher blood levels of total cholesterol (p int. = 0.016), non-HDL-c (p int. = 0.024), and LDL-c (p int. = 0.030) were found only in carriers of the APOE ε2 allele with a low consumption of MUFA. In contrast, carriers of the APOE ε4 allele with a high ω-6:ω-3 PUFA ratio in the diet had higher %HbA1c blood concentrations (p int. = 0.035). Conclusion This study suggests a differential metabolic impact of APOE alleles on lipid/glycemic phenotypes depending on the dietary intake, with important potential implications in the personalized medicine and nutritional management of patients with type 2 diabetes mellitus.

The effects of genetic polymorphisms of APOE on circulating lipid levels in middle-aged and elderly chinese Fujian Han population: toward age- and sex-personalized management

“…The hybrid product was colored by the chromogenic agent, and the images in the chip were scanned and the genotype was determined. At the same time, the APOE genotype was further confirmed by Sanger sequencing and blasted in the GenBank [ 18 ]. The primers for the Sanger sequencing are as follows: forward primer (5’->3’), GACCATGAAGGAGTTGAAGGCCTAC; reverse primer (5’->3’), CTCGCGGGCCCCGGCCTGGTA.…”

Effect of Metformin on Glycemic Control Regarding Carriers of the SLC22A1/OCT1 (rs628031) Polymorphism and Its Interactions with Dietary Micronutrients in Type 2 Diabetes

“…The nutritional analyses in study subjects reflect what previous urban diet studies of western Mexico have published: a high intake of refined sugars accompanied by low fiber intake, an unhealthy composition of dietary fats, as well as micronutrients such as calcium, magnesium, zinc and potassium. 10 , 27 , 28 In the three anti-hyperglycemic therapy groups, the nutritional composition resembles the “westernized diet”, which is usually deleterious for carbohydrate and lipid metabolism, and is reflected in the BMI with higher frequency of overweight and obesity, total body fat and waist circumference, independently of anti-hyperglycemic therapy. 28 In addition, this high dietary fat intake and excessive total body fat could downregulate SLC22A1/OCT1 gene expression as shown by study of Lu et al, and consequently, the pharmacokinetics of metformin and its therapeutic effect.…”

“…Moreover, our results are consistent with previous reports analyzing the role of DRD2 and APOE gene variants on glycemic outcomes in T2D patients through nutritional interactions. 10 , 33 This association between higher calcium and potassium consumption with the increase in %HbA1c and TyG index in T2D patients carrying the risk allele A of polymorphism of SLC22A1/OCT1 gene (rs628031) has an important clinical significance because there are populations such as the Caucasian European whose prevalence of this risk allele A is close to 50% and the prevalence of osteoporosis after 60 years of age is greater than 10%, and in these adult patients, the recommended calcium daily intake is between 800 and 1200 mg, which could affect glycemic control. 34 , 35 …”

“…From a cohort of 432 patients with T2D, 10 a total of 240 subjects were included in this cross-sectional study. Participants received nutritional consultations and psychological counseling from the nutritional program “DIABETIMSS”.…”

Differential distribution of gene polymorphisms associated with hypercholesterolemia, hypertriglyceridemia, and hypoalphalipoproteinemia among Native American and Mestizo Mexicans

“…In the case of high-density lipoprotein cholesterol (HDL-c), the ABCA1 R230C variant has been strongly associated with hypoalphalipoproteinemia (HALP), particularly in NA[ 17 ]. Additionally, the MTTP -943 G/T and the MTHFR C677T variants, as well as the APOE2 allele, have been associated with increased triglycerides levels[ 18 , 19 , 20 ].…”