Ly6h Regulates Trafficking of Alpha7 Nicotinic Acetylcholine Receptors and Nicotine-Induced Potentiation of Glutamatergic Signaling

Abstract

␣7 nAChRs are expressed widely throughout the brain, where they are important for synaptic signaling, gene transcription, and plastic changes that regulate sensory processing, cognition, and neural responses to chronic nicotine exposure. However, the mechanisms by which ␣7 nAChRs are regulated are poorly understood. Here we show that trafficking of ␣7-subunits is controlled by endogenous membrane-associated prototoxins in the Ly6 family. In particular, we find that Ly6h reduces cell-surface expression and calcium signaling by ␣7 nAChRs. We detect Ly6h in several rat brain regions, including the hippocampus, where we find it is both necessary and sufficient to limit the magnitude of ␣7-mediated currents. Consistent with such a regulatory function, knockdown of Ly6h in rat hippocampal pyramidal neurons enhances nicotine-induced potentiation of glutamatergic mEPSC amplitude, which is known to be mediated by ␣7 signaling. Collectively our data suggest a novel cellular role for Ly6 proteins in regulating nAChRs, which may be relevant to plastic changes in the nervous system including rewiring of glutamatergic circuitry during nicotine addiction.

Mechanisms of Inhibition and Potentiation of α4β2 Nicotinic Acetylcholine Receptors by Members of the Ly6 Protein Family

“…Molecular Biology-Mouse Ly6 genes were cloned from expressed sequence tags (ESTs) (Open Biosystems) or from adult CD1 mouse brain cDNA as previously described (35). ␣4-HA was generated by PCR amplifying ␣4 from GFP-␣4-pciNeo (gift from Dr. H. Lester) with the following primers (5Ј-3Ј): F: AAAAGCTTACCATGGAGATCGGGGGCTCCG; R: TCTAGAGAGCTAGGTGCCGCTATTCC and subcloned into pcDNA3 in-frame with a C-terminal hemagglutinin (HA) tag (36) between the HindIII and Xba1 sites.…”

“…Primary Rat Neuron Cultures and RT-PCR-Primary hippocampal and cortical neurons were prepared from P2 rat tissue obtained by tissue transfer protocol T14121 from Joan Heller Brown as previously described (35). mRNA was extracted from these cells, and RT-PCR was performed as previously described (35) with the following primers (5Ј-3Ј): Lynx2-F: CGGCATCGCAGCAACTTTTTG; Lynx2-R: TTG-CAAAGAGGGGTGTTGCAG; Ly6g6e-F: CTGTTACACCT-GCAGCTTTGCC; Ly6g6e-R: GGTAGCAGAGTCATGAG-GGGA AG.…”

“…mRNA was extracted from these cells, and RT-PCR was performed as previously described (35) with the following primers (5Ј-3Ј): Lynx2-F: CGGCATCGCAGCAACTTTTTG; Lynx2-R: TTG-CAAAGAGGGGTGTTGCAG; Ly6g6e-F: CTGTTACACCT-GCAGCTTTGCC; Ly6g6e-R: GGTAGCAGAGTCATGAG-GGGA AG.…”

“…Electrophysiology-Whole-cell patch clamp electrophysiology was used to measure agonist-evoked currents from HEKtsa cells ϳ48 h after transfection as previously described (35). pBOB GFP was included with wild-type nAChR and Ly6 cDNAs to visualize transfected cells for recordings.…”

“…We previously cloned 9 Ly6 genes from mouse brain ESTs or total mouse brain cDNA (35). To test if the encoded Ly6 proteins could modulate ␣4␤2 nAChR activity, we individually coexpressed them with mouse ␣4␤2 nAChRs in transiently transfected HEKtsa cells.…”