Magnesium protects against cisplatin-induced acute kidney injury by regulating platinum accumulation

Abstract

Despite its success as a potent antineoplastic agent, ∼25% of patients receiving cisplatin experience acute kidney injury (AKI) and must discontinue therapy. Impaired magnesium homeostasis has been linked to cisplatin-mediated AKI, and because magnesium deficiency is widespread, we examined the effect of magnesium deficiency and replacement on cisplatin-induced AKI in physiologically relevant older female mice. Magnesium deficiency significantly increased cisplatin-associated weight loss and markers of renal damage (plasma blood urea nitrogen and creatinine), histological changes, inflammation, and renal cell apoptosis and modulated signaling pathways (e.g., ERK1/2, p53, and STAT3). Conversely, these damaging effects were reversed by magnesium. Magnesium deficiency alone significantly induced basal and cisplatin-mediated oxidative stress, whereas magnesium replacement attenuated these effects. Similar results were observed using cisplatin-treated LLC-PK1 renal epithelial cells exposed to various magnesium concentrations. Magnesium deficiency significantly amplified renal platinum accumulation, whereas magnesium replacement blocked the augmented platinum accumulation after magnesium deficiency. Increased renal platinum accumulation during magnesium deficiency was accompanied by reduced renal efflux transporter expression, which was reversed by magnesium replacement. These findings demonstrate the role of magnesium in regulating cisplatin-induced AKI by enhancing oxidative stress and thus promoting cisplatin-mediated damage. Additional in vitro experiments using ovarian, breast, and lung cancer cell lines showed that magnesium supplementation did not compromise cisplatin's chemotherapeutic efficacy. Finally, because no consistently successful therapy to prevent or treat cisplatin-mediated AKI is available for humans, these results support developing more conservative magnesium replacement guidelines for reducing cisplatin-induced AKI in cancer patients at risk for magnesium deficiency.

Premedication with intravenous magnesium has a protective effect against cisplatin-induced nephrotoxicity

“…It is known that oxidative stress is a contributory factor for the development of CIN, and there is the possibility that the antioxidative effect of magnesium premedication might be involved in the alleviation of CIN. Solanki et al reported that mice fed a magnesium-deficient diet developed renal oxidative stress and that the oxidative stress was enhanced by cisplatin administration but was completely inhibited by magnesium supplementation [28]. Even though the dose of cisplatin in their study was much higher than the clinical dosage, these results support to explain the mechanism of CIN.…”

Obesity shifts house dust mite-induced airway cellular infiltration from eosinophils to macrophages: effects of glucocorticoid treatment

“…Total RNA was isolated using the RNeasy Plus Universal kit (Qiagen, Valencia,CA). Expression of F480 , Fizz1 , Arg1 and Nos2 mRNA were determined using a reverse transcription-based quantitative PCR (qPCR) using the Roche Lightcycler ® 480 with target-specific primers and the Roche UniversalProbe library (See Table 1), as previously described [18]. Using Power SYBR ® Green (ThermoFisherScientific, Waltham, MA) technology, mouse Gra (forward: 5’AAAGAGCTAGGAAAAGCCATTGTC3’; reverse: 5’TCAGCTAACATCTCTGGGAATTCA3’) and Grb (forward: 5’AAAGAGCTAGGAAAAGCCATTGTC 3’; reverse: 5’CTGTCTTTGGGCTTTTGAGATAGG3’) mRNA expression were determined by qPCR, as previously described [19] using the ABI 7900HT (7900 emulation mode) with a thermocycling protocol recommended by the manufacturer and mouse Actb as the housekeeping gene (forward: 5’CGGTTCCGATGCCCTGAGGCTCTT3’; reverse: 5’CGTCACACTTCATGATGGAATTGA3’).…”

Influence of magnesium and parathyroid hormone on cisplatin-induced nephrotoxicity in esophageal squamous cell carcinoma

“…Hypomagnesemia reduces the expression of certain transporters in renal tubules in order to maintain serum Mg concentrations. This reduction in tubular transporters also amplifies the renal accumulation of cisplatin, which is accompanied by further nephrotoxicity (20)(21)(22). In this vicious cycle, we hypothesize that Mg supplementation protects against nephrotoxicity by blocking the augmented accumulation of cisplatin.…”

“…Large amounts of hydration with saline, mannitol and furosemide are accepted as the standard of care for patients treated with regimens containing high-dose (≥60 mg/m 2 ) cisplatin (3,10,11). Previous studies have demonstrated that Mg supplementation also confers protective effects against cisplatin-induced nephrotoxicity (10,(20)(21)(22).…”