Maternal exposure to di-n-butyl phthalate induces alterations of c-Myc gene, some apoptotic and growth related genes in pups’ testes

Abstract

The aim of this study was to investigate the effects of maternal exposure to di-( n-butyl) phthalate (DBP) on testicular development and function in pre-pubertal and post-pubertal male rat offspring. Fourteen pregnant female rats were equally divided into two groups: a control group and a DBP-treated group. During gestation day (GD) 12 to postnatal day (PND) 14, the control group was administered 1 ml/day corn oil, and the DBP-treated group was administered DBP 500 mg/kg/day by oral gavage. On PND 25 (pre-puberty) and PND 60 (post-puberty), blood for serum and the testes were collected from five male offspring of each group. To determine the relationship between the methylation state of the c-Myc promoter and the expression of the c-Myc gene, some apoptotic-related genes, such as p53 and Bax, the anti-apoptotic Bcl-2 gene, and some growth arrest-related genes, such as BRD7 and GAS1, were examined. Compared with the control ( p < 0.05), at pre-puberty, DBP induces c-Myc hyper-methylation with significant downregulation for c-Myc, p53, Bax genes, and significant upregulation for Bcl-2, BRD7, and GAS1, while at post puberty, the methylation state and expression of c-Myc and apoptosis-related genes returned to control levels in the same sequence with the fold change in the expression of BRD7 and GAS1 genes. These findings suggest that DBP induced a transient pre-pubertal increase in c-Myc promoter methylation that may be associated with disruption of both apoptotic and growth mechanisms in the testes.

Exposure to Dibutyl Phthalate and Reproductive-Related Outcomes in Animal Models: Evidence From Rodents Study

“…Dibutyl phthalate was a common chemical substance, which may affect developmental plasticity and damage reproductive organ weight such as the testis and seminal vesicle ( Jiang et al, 2017 ; Barakat et al, 2019 ; Chen et al, 2020 ). As a matter of fact, it has been widely studied that DBP affected spermatogenesis and reproductive organ weight through endocrine disruption ( Moody et al, 2014 ; Gardner et al, 2016 ; Pan et al, 2017 ; Rashad et al, 2018 ). However, the role of DBP in different exposure periods, different exposure days, and the safe dose was still controversial.…”

Screening for polystyrene nanoparticle toxicity on kidneys of adult male albino rats using histopathological, biochemical, and molecular examination results

“…One of the vital components in renal apoptosis is caspase-3 (Jeruc et al 2006 ; Ahmed et al 2021 ). At the point when the sign advancing cell development vanishes, Cytc overexpression causes apoptosis (Rashad et al 2018 ). Both intrinsic and extrinsic pathways of the apoptotic cycle can trigger the initiation of caspase 3.…”

Ameliorative effect of N‐acetylcysteine on the testicular tissue of adult male albino rats after glyphosate‐based herbicide exposure

“…Subsequently, 2 µg of isolated total RNA was reverse‐transcribed into complementary DNA. The primer pairs of Bax forward: ACCAAGCTGAGCGAGG, reverse: CCAGTTGAAGTTGCCGTCTG, [ 37 ] Cytc forward: TACCCTCTCAACGACAGCAG, reverse: TCTTGACATTCTCCTCGGTG, [ 38 ] and NRF2 gene sense primer: 5′‐GGCCCTCAATAGTGCTCAG‐3′; antisense primer: 5′‐TAGGCACCTGTGGCAGATTC‐3′ [ 39 ] were used for qRT‐PCR analysis. SYBR Green PCR Master Mix was used for RT‐PCR analysis.…”