Maturatio of 5‐S rRNA: Ribonuclease E Cleavages and Their Dependence on Precursor Sequences

Roy, Monoj K.; Singh, Balraj; Ray, Bimal K.; Apirion, David

doi:10.1111/j.1432-1033.1983.tb07238.x

Cited by 54 publications

(36 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…This is surprising because RNase E, the enzyme that generates the pre-SS RNA molecule, is thought to cleave at the +3 position (4). There are several possible explanations for these apparent discrepancies: (i) The earlier studies on RNase E cleavage specificity were carried out in vitro and with rRNA precursors derived from only a few of the seven rrn operons (3,4,22). The studies presented here are based on the accumulation of 5S RNA products in vivo from all the operons and thus may differ substantially from the earlier work.…”

Section: Discussioncontrasting

confidence: 47%

“…The 5S RNA is released from the larger precursor RNA by the action of an endoribonuclease, RNase E (3). The product of this reaction is a pre-5S RNA molecule that contains 3 extra nucleotides at each end (4). The three 5' residues are thought to be removed by an exonucleolytic process (5), but no information is available on how the mature 3' end of 5S RNA is generated.…”

mentioning

confidence: 99%

See 1 more Smart Citation

The tRNA processing enzyme RNase T is essential for maturation of 5S RNA.

Deutscher

1995

Proc. Natl. Acad. Sci. U.S.A.

102

View full text Add to dashboard Cite

The maturation of 5S RNA in Escherichia coli is poorly understood. Although it is known that large precursors of 5S RNA accumulate in mutant cells lacking the endoribonuclease RNase E, almost nothing is known about how the mature 5' and 3' termini of these molecules are generated. We have examined 5S RNA Eight exoribonucleases that remove nucleotides in the 3' to 5' direction have been identified in E. coli (8, 9), and mutant strains lacking many of these enzymes, alone or in combination, are available (8, 10, 11). We have used these strains in combination with Northern blot analysis to address the question of whether any of these RNases might participate in the maturation of 5S RNA. Our results indicate that RNase T (12), an enzyme previously shown to participate in tRNA end turnover and tRNA processing (2), is required for maturation of the 3' terminus of 5S RNA. In the absence of RNase T, aThe publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.5S RNA molecule with 2 extra residues at its 3' end accumulates. Interestingly, cells containing this incompletely processed molecule and devoid of mature 5S RNA are nevertheless viable and grow only slightly slower than wild-type cells. MATERIALS AND METHODSBacterial Strains and Plasmids. E. coli K-12 strain CA244 (lacZ, trp, relA, spoT) (11) was considered wild type for these studies. Exoribonuclease-deficient derivatives of CA244 were constructed by P1 transduction as described (10,11,13 RNA Preparation. Cells were grown in YT medium to A550 1. Total RNA was isolated by phenol extraction as described (16). The RNA was used for analysis without further fractionation. rRNA was isolated from the ribosome fraction of cell extracts prepared as described (17). 5S RNA was purified from the total RNA of strain CA244 by gel filtration on Sephadex G-100.RNase T Treatment. Total RNA, 5S RNA, or ribosomes were treated with purified RNase T in 20 mM glycine-NaOH, pH 8.9/10 mM MgCl2/5 mM dithiothreitol. Samples were incubated at 37°C for various times and diluted immediately into ice-cold gel loading buffer containing 25 mM Tris HCl (pH 7.5), 0.5 mM EDTA (pH 8.0), 50% formamide, 0.1% xylene cyanol, and 0.1% bromphenol blue.Northern Blot Analysis. RNA samples, dissolved in gel loading buffer, were loaded on a 5% polyacrylamide/8.3 M urea sequencing gel. The gel was run at 1700 V until the xylene cyanol dye migrated 31 cm. The RNA was transferred to a GeneScreenPlus membrane (DuPont) by electroblotting. The RNA was hybridized with a chemically synthesized 22-mer deoxyoligonucleotide, GTTCGGCATGGGGTCAGGTGGG, complementary to residues 26-47 of 5S RNA, and labeled with 32P at its 5' end. The membrane was prehybridized at 42°C for 30 min in buffer containing 4x SSC, 0.5% SDS, lx Denhardt's solution, and 0.1 mg of denatured salmon sperm DNA per ml. Hybridization was carried out at 42°C overnight in the same buffer containing 0...

show abstract

Section: Discussioncontrasting

confidence: 47%

mentioning

confidence: 99%

The tRNA processing enzyme RNase T is essential for maturation of 5S RNA.

Deutscher

1995

Proc. Natl. Acad. Sci. U.S.A.

102

View full text Add to dashboard Cite

show abstract

“…The 39 end maturation of this RNA is also likely to be carried out by an endonuclease, but the identity of this enzyme is unknown. For 5S rRNA, the RNase III-generated product is subsequently cleaved at both the 59 and 39 ends by RNase E (Roy et al 1983). The resulting product still retains 3 nt of precursor sequences at both the 59 and 39 ends.…”

Section: Introductionmentioning

confidence: 99%

Role of precursor sequences in the ordered maturation of E. coli 23S ribosomal RNA

Gutgsell¹,

Jain²

2011

RNA

View full text Add to dashboard Cite

The maturation of ribosomal RNAs (rRNAs) is an important but incompletely understood process required for rRNAs to become functional. In order to determine the enzymes responsible for initiating 39 end maturation of 23S rRNA in Escherichia coli, we analyzed a number of strains lacking different combinations of 39 to 59 exo-RNases. Through these analyses, we identified RNase PH as a key effector of 39 end maturation. Further analysis of the processing reaction revealed that the 23S rRNA precursor contains a CC dinucleotide sequence that prevents maturation from being performed by RNase T instead. Mutation of this dinucleotide resulted in a growth defect, suggesting a strategic significance for this RNase T stalling sequence to prevent premature processing by RNase T. To further explore the roles of RNase PH and RNase T in RNA processing, we identified a subset of transfer RNAs (tRNAs) that contain an RNase T stall sequence, and showed that RNase PH activity is particularly important to process these tRNAs. Overall, the results obtained point to a key role of RNase PH in 23S rRNA processing and to an interplay between this enzyme and RNase T in the processing of different species of RNA molecules in the cell.

show abstract

“…The 9S rRNA includes an extra 84 nt at the 5Ј end and 42 nt at the 3Ј end. Both termini become rapidly processed by RNase E, which leaves 3 nt at both ends (180). Final maturation at the 3Ј end has been shown to depend on the exoribonuclease RNase T (121), while the RNase active at the 5Ј end is still unknown.…”

mentioning

confidence: 99%

Ribosome Biogenesis and the Translation Process inEscherichia coli

Kaczanowska

Rydén-Aulin

2007

Microbiol Mol Biol Rev

359

379

View full text Add to dashboard Cite

SUMMARY Translation, the decoding of mRNA into protein, is the third and final element of the central dogma. The ribosome, a nucleoprotein particle, is responsible and essential for this process. The bacterial ribosome consists of three rRNA molecules and approximately 55 proteins, components that are put together in an intricate and tightly regulated way. When finally matured, the quality of the particle, as well as the amount of active ribosomes, must be checked. The focus of this review is ribosome biogenesis in Escherichia coli and its cross-talk with the ongoing protein synthesis. We discuss how the ribosomal components are produced and how their synthesis is regulated according to growth rate and the nutritional contents of the medium. We also present the many accessory factors important for the correct assembly process, the list of which has grown substantially during the last few years, even though the precise mechanisms and roles of most of the proteins are not understood.

show abstract

Maturatio of 5‐S rRNA: Ribonuclease E Cleavages and Their Dependence on Precursor Sequences

Cited by 54 publications

References 34 publications

The tRNA processing enzyme RNase T is essential for maturation of 5S RNA.

The tRNA processing enzyme RNase T is essential for maturation of 5S RNA.

Role of precursor sequences in the ordered maturation of E. coli 23S ribosomal RNA

Ribosome Biogenesis and the Translation Process inEscherichia coli

Contact Info

Product

Resources

About