-mec-A-mediated Resistance in Staphylococcus aureus in a Referral Hospital, Tehran, Iran

Abstract

Background:The emerge of rapid and accurate detection of Meticillin-Resistant Staphylococcus aureus (MRSA) has been highlighted.Objectives:The current study evaluated the prevalence of mec-A gene in biological specimens of various medical wards, in order to determine any possible relationship.Patients and Methods:Using traditional culture methods, 250 isolates were detected. The prevalence of mec-A mediated resistance was evaluated by PCR method.Results:Among 98 isolates (39.2%) with resistant inhibition zones, 92 isolates carried mec-A gene and were considered as MRSA. Significantly higher rate of MRSA was observed in the specimens from emergency department and intensive care unit (P value < 0.001). Although, the prevalence of MRSA was higher in patients with history of previous hospital admission within the past three months (P = 0.006), but only one case with the same history was hospitalized in the emergency ward that was among the wards with the highest rate of MRSA.Conclusions:The study findings show that, although there is higher rate of MRSA infection in patients with history of hospitalization, but even in cases without any history of medical admission, more detailed questions emphasizing on receiving any recent health care should be asked in a referral hospital, in order to determine the true community-acquired MRSA.

Antibiogram of methicillin resistant Staphylococcus aureus (MRSA) of animal origin from Chhattisgarh

“…Only one isolate out of five S. aureus was found positive for mecA gene (Fig 3) and confirmed as MRSA. All twelve MRSA isolates of repository were reported positive for mecA gene and yielded 533 bp PCR products which is similar to previous findings [6] .…”

“…MRSA isolates were rescreened for MRSA specific mecA gene (Forward-5' AAAATCGATGGTAAAGGTTGGC 3'and Reverse-5' AGTTCTGCAGTACCGGATTTGC 3') by conventional PCR [6] . Confirmation of newer isolates as Staphylococcus aureus was done using Staphylococcus aureus specific nuc gene [7] primer (Forward-5' GCGATTGATGGTGATACGGTT 3'and Reverse-5' AGCCAAGCCTTGACGAACTAAAGC 3') and further confirmation as MRSA by MRSA specific mecA based primer in PCR.…”

Phenotypic and Molecular Characterization of Methicillin-Resistant Staphylococcus Aureus Isolated from Bovine Mastitis in Egypt

“…The high resistance to various antimicrobials agents complicated the treatment of infections and led to lose of value of antibiotics. The mecA gene that encoded the penicillin-binding protein2a (PBP2a) which responsible for methicillin resistance and β lactams antibiotics in staphylococcus species (Rajabiani, et al 2014). Several molecular techniques as PCR has been applied as a common, rapid, and specific approaches for detection of different DNA genes among many bacterial mastitis (Taponen et al, 2009).…”

MecA gene and methicillin-resistant Staphylococcus aureus (MRSA) isolated from dairy farms in East Java, Indonesia

“…Ltd, M118) and inoculated on Muller Hinton agar (Oxoid, CM0337). The primers used namely mecA F: 5 '-GAA ATG GAA CGT CCG ATA A-3' and mecA R: 5 '-CCA ATT CCA CAT TGT TTC CTA A-3' (Rajabiani et al 2014;Rahmaniar et al 2020). The master mixture uses GoTaq® Green Master Mix (Promega, 9PIM712) which is a premixed ready-to-use solution containing Taq DNA polymerase, dNTPs, MgCl2, and buffers reaction.…”