Metformin Mitigates Nickel-Elicited Angiopoietin-Like Protein 4 Expression via HIF-1α for Lung Tumorigenesis

Kang, Yuting; Hsu, Wen-Cheng; Ou, Chu‐Chyn; Tai, Hui-Chun; Hsu, Hui‐Ting; Yeh, Kun‐Tu; Ko, Jiunn‐Liang

doi:10.3390/ijms21020619

Cited by 11 publications

(8 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Individual clones were identified by their unique TRC number: shLuc TRCN0000072249 for vector control targeted to luciferase; shp53 TRCN0000003755 (responding sequence: GTCCAGATGAAGCTCCCAGAA) targeted to p53. The detailed steps of lentivirus infection have been previously described [ 15 ].…”

Section: Methodsmentioning

confidence: 99%

Suppression of PI3K/Akt/mTOR/c-Myc/mtp53 Positive Feedback Loop Induces Cell Cycle Arrest by Dual PI3K/mTOR Inhibitor PQR309 in Endometrial Cancer Cell Lines

Hsin

Shen

Chang

et al. 2021

Cells

Self Cite

View full text Add to dashboard Cite

Gene mutations in PIK3CA, PIK3R1, KRAS, PTEN, and PPP2R1A commonly detected in type I endometrial cancer lead to PI3K/Akt/mTOR pathway activation. Bimiralisib (PQR309), an orally bioavailable selective dual inhibitor of PI3K and mTOR, has been studied in preclinical models and clinical trials. The aim of this study is to evaluate the anticancer effect of PQR309 on endometrial cancer cells. PQR309 decreased cell viability in two-dimensional and three-dimensional cell culture models. PQR309 induced G1 cell cycle arrest and little cell death in endometrial cancer cell lines. It decreased CDK6 expression and increased p27 expression. Using the Proteome Profiler Human XL Oncology Array and Western blot assay, the dual inhibitor could inhibit the expressions of c-Myc and mtp53. KJ-Pyr-9, a c-Myc inhibitor, was used to prove the role of c-Myc in endometrial cancer survival and regulating the expression of mtp53. Knockdown of mtp53 lowered cell proliferation, Akt/mTOR pathway activity, and the expressions of c-Myc. mtp53 silence enhanced PQR309-inhibited cell viability, spheroid formation, and the expressions of p-Akt, c-Myc, and CDK6. This is the first study to reveal the novel finding of the PI3K/mTOR dual inhibitor in lowering cell viability by abolishing the PI3K/Akt/mTOR/c-Myc/mtp53 positive feedback loop in endometrial cancer cell lines.

show abstract

Section: Methodsmentioning

confidence: 99%

Suppression of PI3K/Akt/mTOR/c-Myc/mtp53 Positive Feedback Loop Induces Cell Cycle Arrest by Dual PI3K/mTOR Inhibitor PQR309 in Endometrial Cancer Cell Lines

Hsin

Shen

Chang

et al. 2021

Cells

Self Cite

View full text Add to dashboard Cite

show abstract

“…The complete protocol for chromatin immunoprecipitation (ChIP) assay has been described in a previous publication. 22 DNA was immunoprecipitated with the anti-Sp1 (07645, Millipore, Burlington, USA), anti-acetyl-histone H3 (ab1791, Abcam, Cambridge, UK) and the rabbit IgG (12-370, Millipore, Burlington, USA) as the negative control. A total of 10% of the DNA solution was collected before adding the antibody as an internal control.…”

Section: Chromatin Immunoprecipitation Assaymentioning

confidence: 99%

Exposure to nickel chloride induces epigenetic modification on detoxification enzyme glutathione S‐transferase M2

Kang,

Yang,

Huang

et al. 2023

Environmental Toxicology

Self Cite

View full text Add to dashboard Cite

Nickel (Ni) is a human carcinogen with genotoxic and epigenotoxic effects. Environmental and occupational exposure to Ni increases the risk of cancer and chronic inflammatory diseases. Our previous findings indicate that Ni alters gene expression through epigenetic regulation, specifically impacting E‐cadherin and angiopoietin‐like 4 (ANGPTL4), involved in epithelial‐mesenchymal transition and migration. GST‐M2, a member of the glutathione S‐transferase (GST) enzyme family, plays a crucial role in cellular defense against oxidative damage and has been increasingly associated with cancer. GST‐M2 overexpression inhibits lung cancer invasion and metastasis in vitro and in vivo. Hypermethylation of its promoter in cancer cells reduces gene expression, correlating with poor prognosis in non‐small‐cell lung cancer patients. The impact of Ni on GST‐M2 remains unclear. We will investigate whether nickel exerts regulatory effects on GST‐M2 through epigenetic modifications. Additionally, metformin, an antidiabetic drug, is being studied as a chemopreventive agent against nickel‐induced damage. Our findings indicate that nickel chloride (NiCl2) exposure, both short‐term and long‐term, represses GST‐M2 expression. However, the expression can be restored by demethylation agent 5‐aza‐2′‐deoxycytidine and metformin. NiCl2 promotes hypermethylation of the GST‐M2 promoter, as confirmed by methylation‐specific PCR and bisulfite sequencing. Additionally, NiCl2 also influences histone acetylation, and metformin counteracts the suppressive effect of NiCl2 on histone H3 expression. Metformin reestablishes the binding of specificity protein 1 to the GST‐M2 promoter, which is otherwise disrupted by NiCl2. These findings elucidate the mechanism by which Ni reduces GST‐M2 expression and transcriptional activity, potentially contributing to Ni‐induced lung carcinogenesis.

show abstract

“…Angiopoietin-like protein 4 (ANGPTL4) is induced by hypoxia, and its high expression is associated with progression and poor prognosis in several types of cancers [ 106 , 107 ]. Kang et al found that ANGPTL4 was up-regulated in Ni-treated BEAS-2B and lung cancer cell lines [ 108 ]. Mechanistic studies indicated that Ni induced accumulation of HIF-1α, which mediated the transcriptional activation of ten-eleven translocation methylcytosine dioxygenase 1 (TET1), a demethylase that mediates the first step toward DNA demethylation by converting 5-mC into 5-hmC [ 109 , 110 ].…”

Section: Nickel (Ni)mentioning

confidence: 99%

Epigenetic Regulation in Chromium-, Nickel- and Cadmium-Induced Carcinogenesis

Zhao

Islam

Wang

et al. 2022

Cancers

View full text Add to dashboard Cite

Environmental and occupational exposure to heavy metals, such as hexavalent chromium, nickel, and cadmium, are major health concerns worldwide. Some heavy metals are well-documented human carcinogens. Multiple mechanisms, including DNA damage, dysregulated gene expression, and aberrant cancer-related signaling, have been shown to contribute to metal-induced carcinogenesis. However, the molecular mechanisms accounting for heavy metal-induced carcinogenesis and angiogenesis are still not fully understood. In recent years, an increasing number of studies have indicated that in addition to genotoxicity and genetic mutations, epigenetic mechanisms play critical roles in metal-induced cancers. Epigenetics refers to the reversible modification of genomes without changing DNA sequences; epigenetic modifications generally involve DNA methylation, histone modification, chromatin remodeling, and non-coding RNAs. Epigenetic regulation is essential for maintaining normal gene expression patterns; the disruption of epigenetic modifications may lead to altered cellular function and even malignant transformation. Therefore, aberrant epigenetic modifications are widely involved in metal-induced cancer formation, development, and angiogenesis. Notably, the role of epigenetic mechanisms in heavy metal-induced carcinogenesis and angiogenesis remains largely unknown, and further studies are urgently required. In this review, we highlight the current advances in understanding the roles of epigenetic mechanisms in heavy metal-induced carcinogenesis, cancer progression, and angiogenesis.

show abstract

Metformin Mitigates Nickel-Elicited Angiopoietin-Like Protein 4 Expression via HIF-1α for Lung Tumorigenesis

Cited by 11 publications

References 32 publications

Suppression of PI3K/Akt/mTOR/c-Myc/mtp53 Positive Feedback Loop Induces Cell Cycle Arrest by Dual PI3K/mTOR Inhibitor PQR309 in Endometrial Cancer Cell Lines

Suppression of PI3K/Akt/mTOR/c-Myc/mtp53 Positive Feedback Loop Induces Cell Cycle Arrest by Dual PI3K/mTOR Inhibitor PQR309 in Endometrial Cancer Cell Lines

Exposure to nickel chloride induces epigenetic modification on detoxification enzyme glutathione S‐transferase M2

Epigenetic Regulation in Chromium-, Nickel- and Cadmium-Induced Carcinogenesis

Contact Info

Product

Resources

About