Methylation-sensitive high resolution melting (MS-HRM): a new approach for sensitive and high-throughput assessment of methylation

Abstract

In this article, we show that high resolution melting analysis (HRM) is a sensitive and specific method for the detection of methylation. Methylated DNA and unmethylated DNA acquire different sequences after bisulphite treatment resulting in PCR products with markedly different melting profiles. We used PCR to amplify both methylated and unmethylated sequences and assessed HRM for the determination of the methylation status of the MGMT promoter region. Reconstruction experiments showed that MGMT methylation could be detected at levels as low as 0.1%. Moreover, MS-HRM allows for estimation of the methylation level by comparing the melting profiles of unknown PCR products to the melting profiles of PCR products derived from standards with a known unmethylated to methylated template ratio. We used MS-HRM for the analysis of eight cell lines of known methylation status and a panel of colorectal cancer specimens. The simplicity and high reproducibility of the MS-HRM protocol makes MS-HRM the method of choice for methylation assessment in many diagnostic and research applications.

Comparative assessment of 5 methods (methylation‐specific polymerase chain reaction, methylight, pyrosequencing, methylation‐sensitive high‐resolution melting, and immunohistochemistry) to analyze O6‐methylguanine‐DNA‐methyltranferase in a series of 100 glioblastoma patients

“…These experiments were done using mixes of fully methylated template in unmethylated controls, as we did. 22 It is possible that a heterogeneous pattern of methylation at the site of annealing can induce a PCR bias directed toward the unmethylated allele, which could explain a lower sensitivity of methylation-sensitive high-resolution melting for some samples. Finally, it can also be hypothesized that testing CpGs separately is a more clinically relevant option.…”

“…(forward: 5 0 GCGTTTCGGATATGTTGGGATAGT 3 0 and reverse: 5 0 AACGACCCAAACACTCACCAAA 3 0 ), 22 and 1 lL of bisulfite-modified template. The amplification consisted of 10 minutes at 95 C, followed by 50 cycles of 15 seconds at 95 C, 30 seconds at 60 C, and 30 seconds at 72 C. After amplification, a postamplification melting curve program was initiated by heating to 95 C for 1 minute, cooling to 70 C for 30 seconds, and increasing the temperature to 95 C (heating rate 0.01 C/s) while continuously measuring fluorescence.…”

MGMT promoter methylation in malignant gliomas: ready for personalized medicine?

“…33 The latter technique does not depend on bisulfite conversion. Recently developed technologies that analyze bisulfite-converted DNA include methylation-sensitive highresolution melting (MS-HRM; a PCR-based method that differentiates the melting behavior of the amplicons derived from methylated and unmethylated sequences), 34 bead array-based technologies, 35 mass spectroscopy, 36 and denaturing highperformance liquid chromatography. 37 Each technology must define a cut-off point for the prognostic effect of the MGMT methylation status, which needs to be validated prospectively.…”

The ‘golden age’ of DNA methylation in neurodegenerative diseases

“…3. A method to differentiate converted from unconverted bisulfite-treated DNA is based on the use of the high resolution melting analysis (HRM), a real-time PCR-based technique initially designed to distinguish SNPs [ 28 ]. PCR products are directly analyzed by temperature ramping and resulting liberation of the intercalating fluorescent dye during melting.…”