Midbiotics: conjugative plasmids for genetic engineering of natural gut flora

Abstract

The possibility to modify gut bacterial flora has become an important goal, and various approaches are used to achieve desirable communities. However, the genetic engineering of existing microbes in the gut, which are already compatible with the rest of the community and host immune system, has not received much attention. Here, we discuss and experimentally evaluate the possibility to use modified and mobilizable CRISPR-Cas9-endocing plasmid as a tool to induce changes in bacterial communities. This plasmid system (briefly midbiotic) is delivered from bacterial vector into target bacteria via conjugation. Compared to, for example, bacteriophage-based applications, the benefits of conjugative plasmids include their independence of any particular receptor(s) on host bacteria and their relative immunity to bacterial defense mechanisms (such as restriction-modification systems) due to the synthesis of the complementary strand with host-specific epigenetic modifications. We show that conjugative plasmid in association with a mobilizable antibiotic resistance gene targeting CRISPR-plasmid efficiently causes ESBL-positive transconjugants to lose their resistance, and multiple gene types can be targeted simultaneously by introducing several CRISPR RNA encoding segments into the transferred plasmids. In the rare cases where the midbiotic plasmids failed to resensitize bacteria to antibiotics, the CRISPR spacer(s) and their adjacent repeats or larger regions were found to be lost. Results also revealed potential caveats in the design of conjugative engineering systems as well as workarounds to minimize these risks.

Beta-Lactam Sensitive Bacteria Can Acquire ESBL-Resistance via Conjugation after Long-Term Exposure to Lethal Antibiotic Concentration

“…Hypothetically, bacteriophages could serve as an imaginable way to deliver CRISPR-systems to bacteria, e.g., in infected wounds [18]. Alternatively, conjugative plasmids can be engineered to transfer CRISPR-systems [19] and hence utilized within probiotic strains to prophylactically limit the abundance of ESBL-plasmids in gut flora, and therefore the rescue events from taking place. To conclude, evolutionary rescue by horizontal gene transfer is an event where susceptible bacteria may become resistant to antibiotics 'on the fly' after the beginning of the treatment.…”

“…We also evaluated the efficacy of CRISPR-Cas9-encoding plasmid to prevent an evolutionary rescue via horizontal gene transfer. The CRISPR-plasmid used (pCas9-gRNA) targets a conserved region in the blaCTX-M-14 gene with the spacer sequence CCGCTGGTTCTGGTGACCTATTT (described in detail in Ruotsalainen et al, 2019). The original pCas9 plasmid was a gift from Luciano Marraffini (Addgene plasmid #42876) and confers resistance to chloramphenicol.…”

Targeted-Antibacterial-Plasmids (TAPs) combining conjugation and CRISPR/Cas systems achieve strain-specific antibacterial activity

“…Most CRISPR delivery methodology currently in development focus on the use of bacteriophages, which have intrinsically narrow host-range 27 . Besides, several recent studies successfully use the broad host range RK2 conjugation systems to deliver CRISPR system that target E. coli 26,28–30 or S. enterica 31 in vitro . One key advantage of our strategy over these approaches is the versatility conferred by the CSTB algorithm that enables the robust identification of gRNA that should be used to specifically re-target the TAPs against one or several bacterial strains of interest, without targeting other species.…”

“…The second limiting parameter is the efficiency of TAPs transfer towards the targeted strain(s). So far, all of the antibacterial 28,34 or anti-drug 29,30,35 methodology using conjugation are based on the incP RK2 conjugative system, which offer broad-host range, but low efficiency of transfer (10 −4 -10 −5 ). Hamilton et al .…”

Indirect Selection against Antibiotic Resistance via Specialized Plasmid-Dependent Bacteriophages

“…CRISPR-system is originally a bacterial defence mechanism that has later on been adapted for various genetic engineering purposes. By introducing Cas9 together with specific guiding RNA into bacterial cell, the endonuclease nicks the double stranded plasmid DNA [ 14 , 15 , 16 ]. Linearized plasmid cannot be replicated normally, leading to either the loss of plasmid or, in case of plasmid encoded addictive toxin-antitoxin systems, even bacterial death.…”