MiR-218 affects hypertrophic differentiation of human mesenchymal stromal cells during chondrogenesis via targeting RUNX2, MEF2C, and COL10A1

Abstract

Background Human mesenchymal stromal cells (MSC) hold hopes for cartilage regenerative therapy due to their chondrogenic differentiation potential. However, undesirable occurrence of calcification after ectopic transplantation, known as hypertrophic degeneration, remains the major obstacle limiting application of MSC in cartilage tissue regeneration approaches. There is growing evidence that microRNAs (miRs) play essential roles in post-transcriptional regulation of hypertrophic differentiation during chondrogenesis. Aim of the study was to identify new miR candidates involved in repression of hypertrophy-related targets. Methods The miR expression profile in human articular chondrocytes (AC) was compared to that in hypertrophic chondrocytes derived from human MSC by microarray analysis, and miR expression was validated by qPCR. Putative targets were searched by in silico analysis and validated by miR reporter assay in HEK293T, by functional assays (western blotting and ALP-activity) in transiently transfected SaOS-2 cells, and by a miR pulldown assay in human MSC. The expression profile of miR-218 was assessed by qPCR during in vitro chondrogenesis of MSC and re-differentiation of AC. MSC were transfected with miR-218 mimic, and differentiation outcome was assessed over 28 days. MiR-218 expression was quantified in healthy and osteoarthritic cartilage of patients. Results Within the top 15 miRs differentially expressed between chondral AC versus endochondral MSC differentiation, miR-218 was selected as a candidate miR predicted to target hypertrophy-related genes. MiR-218 was downregulated during chondrogenesis of MSC and showed a negative correlation to hypertrophic markers, such as COL10A1 and MEF2C. It was confirmed in SaOS-2 cells that miR-218 directly targets hypertrophy-related COL10A1, MEF2C, and RUNX2, as a gain of ectopic miR-218 mimic caused drop in MEF2C and RUNX2 protein accumulation, with attenuation of COL10A1 expression and significant concomitant reduction of ALP activity. A miR pulldown assay confirmed that miR-218 directly targets RUNX2, MEF2C in human MSC. Additionally, the gain of miR-218 in human MSC attenuated hypertrophic markers (MEF2C, RUNX2, COL10A1, ALPL), although with no boost of chondrogenic markers (GAG deposition, COL2A1) due to activation of WNT/β-catenin signaling. Moreover, no correlation between miR-218 expression and a pathologic phenotype in the cartilage of osteoarthritis (OA) patients was found. Conclusions Although miR-218 was shown to target pro-hypertrophic markers MEF2C, COL10A1, and RUNX2 in human MSC during chondrogenic differentiation, overall, it could not significantly reduce the hypertrophic phenotype or boost chondrogenesis. This could be explained by a concomitant activation of WNT/β-catenin signaling counteracting the anti-hypertrophic effects of miR-218. Therefore, to achieve a full inhibition of the endochondral pathway, a whole class of anti-hypertrophic miRs, including miR-218, needs to be taken into consideration.

MiR-181a Targets RSPO2 and Regulates Bone Morphogenetic Protein – WNT Signaling Crosstalk During Chondrogenic Differentiation of Mesenchymal Stromal Cells

“…In our previous studies using microRNA microarray analyses with application of 1349 miR probes, we identified top 15 differentially expressed miRs that reached over 60-fold changes between MSC that underwent hypertrophic differentiation versus AC that retained the stable mature chondrocyte phenotype during an in vitro chondrogenesis time-course in 3D pellet cultures (Gabler et al, 2015;Melnik et al, 2020). The most striking differential expression profiles were observed for the miR-181 family that also correlated with the progression of the successive maturation stages of chondrogenesis.…”

“…Expression levels of mRNA and miR were calculated using 2-CT method (Rao et al, 2013) and normalized to housekeeping genes Actin Beta (ACTB), Hypoxanthine-guanine phosphoribosyltransferase (HPRT), Ribosomal Protein L13 (RPL13), and Cleavage and Polyadenylation Specific Factor 6 (CPSF6) (for mRNA), or U6 (Small Nuclear Ribonucleoprotein U6, SNRNU6) (for miR). All primers used for the assay were listed before (Melnik et al, 2020). For monitoring expression of human RSPO2 (NM_178565.4) the following primers were used: forward 5 TGTCCAACCATTGCTGAATC3 and reverse 5 TCCTCTTCTCCTTCGCCTTT3 , and human KLF15 1 http://www.targetscan.org/vert_72/ 2 http://mirwalk.umm.uni-heidelberg.de/ 3 https://bioweb.pasteur.fr/packages/pack@miRanda@3.3a 4 https://tools4mirs.org/software/mirna_databases/micrornaorg/ (NM_014079) was measured using forward 5 AGCCGCAG AACTCATCAAAA3 and reverse TTGATGTGCTTGGAGA GGTG.…”

“…Not only miR-181a expression was not elevated in OA cartilage, but it had the tendency to be at lower levels in comparison with the healthy tissue (Figure 6A). Of note, for stratification of cartilage samples, we have additionally applied expression of miR-675 as a decisive factor to verify the segregation of healthy and OA cohorts (Steck et al, 2012;Hecht et al, 2019;Melnik et al, 2020). Nevertheless, when we tested how miR-181a expression correlates with other hypertrophy-related miRs characterized before (Melnik et al, 2020), we found that there was a tight correlation between miR-181a and miR-218 in healthy tissue.…”

“…Of note, for stratification of cartilage samples, we have additionally applied expression of miR-675 as a decisive factor to verify the segregation of healthy and OA cohorts (Steck et al, 2012;Hecht et al, 2019;Melnik et al, 2020). Nevertheless, when we tested how miR-181a expression correlates with other hypertrophy-related miRs characterized before (Melnik et al, 2020), we found that there was a tight correlation between miR-181a and miR-218 in healthy tissue. However, this correlation was completely lost in OA samples (Figure 6B).…”

“…MicroRNAs (miRs) are a class of small (∼ 22 nt) noncoding RNAs expressed in a cell-and tissue-specific manner and regulating a broad range of biological processes on posttranscriptional level by mediating mRNA degradation via direct binding to target mRNAs. In our previous studies, we addressed the question which miRs are involved in regulation of specific phases of chondrogenic maturation, especially hypertrophy (Gabler et al, 2015;Melnik et al, 2020). By miR expression array profiling done with human bone marrow MSC at different stages of chondrogenesis versus re-differentiated articular chondrocytes, we identified a distinct set of stage-specific miRs for the four populations of chondrocytes: prechondrocytes, chondroblasts, mature, and hypertrophic chondrocytes.…”