Mitochondrial damage-induced impairment of angiogenesis in the aging rat kidney

Abstract

Decreased expression of vascular endothelial growth factor (VEGF) in the renal tubules is thought to cause progressive loss of the renal microvasculature with age. Mitochondrial dysfunction may be a principal phenomenon underlying the process of aging. The relation between VEGF expression and mitochondrial dysfunction in aging is not fully understood. We hypothesized that mitochondrial dysfunction blocks VEGF expression and contributes to impaired angiogenesis in the aging kidney. The aim of this study was to assess the role of mitochondria in VEGF expression in the aging rat kidney. We evaluated the accumulation of 8-hydroxy-2 0 -deoxyguanosine in mitochondrial DNA, as well as mitochondrial dysfunction, as assessed by electron microscopy of mitochondrial structure and histochemical staining for respiratory chain complex IV, in aging rat kidney. An increase in hypoxic area and a decrease in peritubular capillaries were detected in the cortex of aging rat kidneys; however, upregulation of VEGF expression was not observed. The expression of VEGF in proximal tubular epithelial cells in response to hypoxia was suppressed by the mitochondrial electron transfer inhibitor myxothiazol. Mitochondrial DNA-deficient cells also failed to upregulate VEGF expression under hypoxic conditions. These results indicate that impairment of VEGF upregulation, possibly as a result of mitochondrial dysfunction, contributes to impaired angiogenesis, which in turn leads to renal injury in the aging rat kidney.

Klotho protects against mouse renal fibrosis by inhibiting Wnt signaling

“…Total mRNA extraction and realtime quantitative RT-PCR were performed as described previously (25). Briefly, total RNA was prepared from the kidney by using TRIzol (Life Technologies, Gaithersburg, MD) followed by digestion with DNase (Sigma Aldrich, St. Louis, MO) to eliminate any contamination of genomic DNA.…”

Angiostatin production increases in response to decreased nitric oxide in aging rat kidney

“…27 We have also previously reported an accumulation of oxidative stress caused by decreased transcription of antioxidant genes in the aged rat kidney. 8 Loss of NO availability in the aged kidney would be expected to result in several adverse effects, including decreased renal perfusion, increased renal vasoconstriction, and enhancement of fibrosis. NO may have a role in modulating matrix deposition in the kidney, the secretion of fibrogenic cytokines, and interstitial fibrosis.…”

“…8 Primers and probes used for rat monocyte chemotactic protein-1 (MCP1), rat interleukin-18 (IL18), rat endothelial NO synthase (eNOS), rat dimethylarginine dimethylaminohydrolase (DDAH) 1, rat DDAH2, and rat vascular endothelial growth factor receptor-2 (VEGFR2) are listed in Supplementary Table 1.…”

“…7 We have reported that altered expression of vascular endothelial growth factor is one of the causes of PTC loss in aged kidney. 8 However, anti-angiogenic humoral factors synthesized in the aging kidney and which may compromise vessel integrity have not been fully elucidated.…”

Maintenance of Endothelial Guanosine Triphosphate Cyclohydrolase I Ameliorates Diabetic Nephropathy

“…41 The primers and probe for human GCH1 (NM_000161) were as follows: forward, agttcaggagcgccttacaa; reverse, ttcaaccactaccccgactc; and probe, atcacggaagccttgcggcc. The primers and probe for mouse GCH1 (NM_008102) were as follows: forward, caagggataccaggagacca; reverse, agccaatatggacccttcct; and probe, ccatgtgtgagcatcaccttgttcc.…”