Mix-infection of S. Typhi and ParaTyphi A in Typhoid Fever and Chronic Typhoid Carriers: A Nested PCR Based Study in North India

Pratap, Chandra Bhan; Kumar, Gagan; Patel, Saurabh K.; Shukla, Vijay Kumar; Kumar, Kailash; Singh, Tej Bali; Nath, Gopal

doi:10.7860/jcdr/2014/9167.5107

Cited by 7 publications

(6 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Paratyphi A, other Salmonella spp. and other related bacteria to ensure the higher level of sensitivity and specificity before testing with clinical samples [ 20 , 44 , 45 ].…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Nucleic Acid-Based Lateral Flow Biosensor for Salmonella Typhi and Salmonella Paratyphi: A Detection in Stool Samples of Suspected Carriers

et al. 2021

View full text Add to dashboard Cite

A multiplex rapid detection system, based on a PCR-lateral flow biosensor (mPCR-LFB) was developed to identify Salmonella Typhi and Salmonella Paratyphi A from suspected carriers. The lower detection limit for S. Typhi and S. Paratyphi A was 0.16 and 0.08 ng DNA equivalent to 10 and 102 CFU/mL, respectively. Lateral flow biosensor was used for visual detection of mPCR amplicons (stgA, SPAint, ompC, internal amplification control) by labeling forward primers with fluorescein-isothiocyanate (FITC), Texas Red, dinitrophenol (DNP) and digoxigenin (DIG) and reverse primers with biotin. Binding of streptavidin-colloidal gold conjugate with the amplicons resulted in formation of a red color dots on the strip after 15–20 min of sample exposure. The nucleic acid lateral flow analysis of the mPCR-LFB was better in sensitivity and more rapid than the conventional agarose gel electrophoresis. Moreover, the mPCR-LFB showed 100% sensitivity and specificity when evaluated with stools spiked with 100 isolates of Salmonella genus and other bacteria. A prospective cohort study on stool samples of 1176 food handlers in outbreak areas (suspected carriers) resulted in 23 (2%) positive for S. Typhi. The developed assay has potential to be used for rapid detection of typhoid carriers in surveillance program.

show abstract

“…Paratyphi A, other Salmonella spp. and other related bacteria to ensure the higher level of sensitivity and specificity before testing with clinical samples [ 20 , 44 , 45 ].…”

Section: Discussionmentioning

confidence: 99%

“…Validation or evaluation with clinical isolates is necessary for prototype development as supported by previous studies that also incorporated S. Typhi, S. Paratyphi A, other Salmonella spp. and other related bacteria to ensure the higher level of sensitivity and specificity before testing with clinical samples [20,44,45].…”

Section: Discussionmentioning

confidence: 99%

Nucleic Acid-Based Lateral Flow Biosensor for Salmonella Typhi and Salmonella Paratyphi: A Detection in Stool Samples of Suspected Carriers

et al. 2021

View full text Add to dashboard Cite

show abstract

“…Typhimurium stm F: GGAATCAATGCCCGCCAATG R: CGTGCTTGAATACCGCCTGTC 523 [ 18 ] S . Infantis fl j B F: TTGCTTCAGCAGATGCTAAG R: CCACCTGCGCCAACGCT 413 This study* S. Typhi staA F: TGGTTACATGACCGGTAGTC R: TAGCTGCCGCAATGGTTATG 537 [ 19 ] S . ParatyphiB Spa F: ACATAATGCTTTTCGTGCTCCTC R: GGCATAAATATCTTTCTCCCCTCC 384 [ 19 ] S. ParatyphiC \ S .Cholereasuis Cspcsc F: TCGAGGGTTAAAGATGGGG R: TACCACACGCTAAGCAACC 708 [ 20 ] S .…”

Section: Methodsmentioning

confidence: 99%

Frequency of Salmonella serotypes among children in Iran: antimicrobial susceptibility, biofilm formation, and virulence genes

et al. 2022

View full text Add to dashboard Cite

Background/significance Salmonella gastroenteritis causes significant morbidity among pediatric patients, mainly in developing world, such as the Middle East and North Africa (MENA) region. Concurrently, data from MENA countries like Iran, regarding prevalence of Salmonella serotypes, antimicrobial susceptibility, and biofilm production is scarce. Material & methods Slide agglutination was used to determine the serogroup of 140 Salmonella isolates recovered from 4477 stool specimens collected from children with gastroenteritis, and isolates were serotyped by PCR assay. The antimicrobial susceptibility of isolates to five first line drugs was assessed by disk diffusion assay using CLSI guidelines. Semi-quantitative evaluation of biofilm production was done by microtiter plate assay followed by PCR detection of biofilm-associated virulence genes csgD, pefA, and bcsA for each isolate. Results Nearly 94% of Salmonella isolates were recovered from ≤ 5-year-old patients, and 99% of isolates were non-typhoidal. While we found extensive diversity among Salmonella isolates, serogroup D (46%) predominated, and Salmonella Enteritidis (41%) was the most common serotype that showed the highest antimicrobial susceptibility rate (> 96%). For the first time in Iran, S. Newport serotype from human specimens was isolated. Most isolates were sensitive to all test antimicrobials, but 35% of isolates were not-typed (NT) that showed the highest resistance with 48% being resistant to ≥ 1 test antimicrobial. Majority of isolates made weak (or no) biofilm, and we found a weak association between antimicrobial susceptibility, biofilm production, or virulence genes csgD, pefA, and bcsA. Conclusions The most effective measure that may control pediatric salmonellosis outbreaks is raising awareness of parents of preschoolers about food safety. Isolation of highly diverse Salmonella serotypes, including many commonly isolated from animals, indicates widespread contamination of the food chain. Majority of serotypes were sensitive to first-line antimicrobials, thus presently, pediatric Salmonella infections in this region may be controlled by conventional antimicrobials. However, despite the current trend, an imminent emergence of resistant Salmonella strains is foreseen, since various serotypes resistant to > 1 antimicrobial agent are typically associated with animals. Our results warrant further investigation that includes correlation analysis of clinical data regarding treatment outcomes, and serotype attributes like virulence genes.

show abstract

“…Typhi and stkG gene of S . Paratyphi A, primers used were taken from the previous studies [ 19 , 20 ] ( Table 1 ).…”

Section: Methodsmentioning

confidence: 99%

Ulcerative Colitis and Its Association withSalmonellaSpecies

Tripathi

Pratap

Dixit

et al. 2016

Interdisciplinary Perspectives on Infectious Diseases

Self Cite

View full text Add to dashboard Cite

Ulcerative colitis (UC) is characterized by presence of ulcer in colon and bloody diarrhea. The present study explores the possibility of association between Salmonella and ulcerative colitis. The present study comprised 59 cases of UC, 28 of colon cancer (CC), 127 of irritable bowel syndrome (IBS), and 190 of healthy control. The serological study was done by Widal and Indirect Haemagglutination Assay (IHA) for ViAb. Nested PCR was performed targeting fliC, staA, and stkG gene for Typhi and Paratyphi A, respectively. A total of 15.3% patients were positive for Salmonella “O” antigen among them 18.6% UC, 35.5% CC, 12.6% IBS, and 15.3% healthy control. A total of 36.9% patients were positive for “H” antigen including 39.0%, 57.1%, and 67.7% UC, CC, and IBS, respectively. About 1.73% show positive agglutination for AH antigen including 3.4%, 3.6%, and 1.6%, UC, CC, and IBS. A total of 10.89% were positive for ViAb. While 6.8% of UC, 10.7% of CC, 11.0% of IBS, and 12.1% of healthy subjects were positive for the antibody, the PCR positivity rates for Salmonella specific sequences were 79.7% in UC, 53.6% in CC, 66.1% in IBS, and 16.3% in healthy controls. The present study suggested that higher prevalence of Salmonella might play important role in etiopathogenesis of UC, IBS, and CC.

show abstract

Mix-infection of S. Typhi and ParaTyphi A in Typhoid Fever and Chronic Typhoid Carriers: A Nested PCR Based Study in North India

Cited by 7 publications

References 17 publications

Nucleic Acid-Based Lateral Flow Biosensor for Salmonella Typhi and Salmonella Paratyphi: A Detection in Stool Samples of Suspected Carriers

Nucleic Acid-Based Lateral Flow Biosensor for Salmonella Typhi and Salmonella Paratyphi: A Detection in Stool Samples of Suspected Carriers

Frequency of Salmonella serotypes among children in Iran: antimicrobial susceptibility, biofilm formation, and virulence genes

Ulcerative Colitis and Its Association withSalmonellaSpecies

Contact Info

Product

Resources

About