Molecular Analysis of Endogenous Avian Leukosis/Sarcoma Virus Genomes in Korean Chicken Embryos

Abstract

ABSTRACT. Since the status of endogenous avian leucosis/sarcoma virus (ALSV) infections in Korean broiler chickens is unclear, this study examined embryonated eggs obtained from broiler farms and Korean native chicken breeds in Korea using PCR with the primer sets specific for endogenous ALSVs. The PCR assays detected the genomes of EAV, ev, ev/J and ART-CH belonging to the endogenous ALSV from all embryos tested. Phylogenetically, the Korean EAV genomes were more closely related to the prototype EAV-0 than to the other prototype, E51. The Korean ART-CH elements clustered together but were distinct from the prototype ART-CH clones, 5 and 14. Although there was comparatively little divergence in the nucleotide and amino acid sequences of the Korean ev and ev/J genomes compared with the other known ev and ev/J genomes, the Korean genomes had phylogenetically distinct branches. From these results, endogenous genomes are quite prevalent in Korean broiler chickens. In addition, the endogenous genomes circulating in Korean broiler chickens are genetically different from the other known endogenous genomes. These results are expected to provide useful information for the control and establishment of a surveillance system for endogenous ALSVs in Korea. KEY WORDS: avian leukosis/sarcoma virus, chickens, genetic divergence, prevalence.J. Vet. Med. Sci. 70(1): 17-23, 2008 Avian leukosis/sarcoma viruses (ALSVs) in chickens are classified into 6 subgroups (A, B, C, D, E and J) based on their host range, viral interference patterns with members of the same and different subgroups, and viral envelope antigens [5,9]. ALSVs can be divided into exogenous or endogenous viruses according to the way they are transmitted in nature [5]. Exogenous viruses (subgroup A, B, C, D and J) are spread as infectious virions, either vertically from hen to progeny through the egg, or horizontally from bird to bird [4]. ALSVs A, B and J are commonly encountered in the field but C and D appear to be rare [5].Endogenous viruses are integrated into the genome through the germline of normal chickens and are transmitted genetically in the Mendelian manner [6,7,14,16]. These include the endogenous viral (ev) loci and the more recently discovered moderately repetitive elements, EAV (endogenous avian virus) and ART-CH (avian retrotransposon from chicken genome), as well as the highly repetitive elements, CR1 (chicken repeat 1). The genetic sequences of the ev loci are related to the subgroup E ALSVs of which there are more than 50 different ev loci [2]. Each chicken has been reported to carry on average of approximately 5 ev loci [5]. Some of ev loci encode infectious endogenous retroviruses closely related to ALSVs, while others are defective [5]. The biological functions of the EAV, ART-CH and CR1 remain to be determined. The EAV family is restricted to all Gallus species, while the evs are specific to domestic chickens and their wild relative red jungle fowl only, and are therefore younger than EAV [2]. EAV is present at approximately 50 copies per h...

Genetic Polymorphism of Avian Leukosis Virus Host Receptors in Korean Native Chickens and Establishment of Resistant Line

“…As ALV has a significant impact on the poultry industry, there have been many studies of Chinse chicken breeds to characterize ALV subgroup strains and the frequency of individuals with resistant alleles (Feng and Zhang, 2016;Su et al, 2018;Cui et al, 2020). Although molecular analysis of the genome of endogenous ALV has been performed in Korea (Kim et al, 2008), there have been no reports of virus resistance alleles in Korean Native chicken breeds. In this study, we analyzed the genome sequences of tva and tvb in the White Leghorn (WL), Korean Ogye (KO), and Korean Native chicken (KNC) breeds, to determine genotype frequencies and their resistance to ALV subgroups A, B, and K, with the aim of preserving superior traits by selective breeding in the future.…”

Çin’de Ekonomik Öneme Sahip Tavukçuluk İşletmelerinde Endojen Retrovirüs Elemanlarının Genomik Analizi

“…The sequencing primer pair for the ART-CHs was derived from the ART-CH gag-related sequences since the ART-CH internal regions were completely defective. [2,22] ART-CH gag-related region F:ctcaaggtggctcatttaac R:acaaagcatggaagacaga 46 657 [2] ev loci env F:ggatgaggtgactaagaaag R:tttgactgtctgcacatctc 48.5 881 [2,18] F:caatcctttctttaacagcg R:taacggaccaacaggctagt 46.5 713 [2] ev/J env F:acaccattggtggcgcgtgtc R:cccgtcacatcgcgttc 48.5 1480 [9] Intact gene F:ttcgtgattggaggaaacacttg R:gttacacttggcacacaaaggtggcataac 60 3900 [9] pol F:ttcgtgattggaggaaacacttg R:cacgtttcctggttgttg 50 568 [15] F: forward primer, R: reverse primer AY013303 AY013304 AY013305 KR188998 KR188999 KR189000 KR189001 KR189002 KR189003 KR189004 KR189005 KR189006 KR189007 E/EAV EAV-0 E51 EAV-BF EAV-GS EAV-LB EAV-LS EAV-PD EAV-RB EAV-SG EAV-SQ EAV-TH EAV-WL X59844 M95189 KR188988 KR188989 KR188990 KR188991 KR188992 KR188993 KR188994 KR188995 KR188996 KR188997 J HPRS-103 Z46390…”

“…ALVs can be further divided into either exogenous or endogenous viruses based on the mechanism of transmission [2] . Exogenous viruses (subgroups A to D and J) can be spread vertically from the hen to the embryo through the egg, or horizontally from chicken to chicken [3] .…”

“…Exogenous viruses (subgroups A to D and J) can be spread vertically from the hen to the embryo through the egg, or horizontally from chicken to chicken [3] . ALV subgroups A, B, and J are common throughout the poultry industry; however, C and D are less common [2][3][4][5] . Among the endogenous viruses, four new ALV subgroups (F to I) were discovered and isolated from wild birds (e.g., pheasant and quail) [6] .…”