Molecular Analysis of Malassezia Microflora on the Skin of Atopic Dermatitis Patients and Healthy Subjects

Abstract

Members of the genus Malassezia, lipophilic yeasts, are considered to be one of the exacerbating factors in atopic dermatitis (AD). We examined variation in cutaneous colonization by Malassezia species in AD patients and compared it with variation in healthy subjects. Samples were collected by applying transparent dressings to the skin lesions of AD patients. DNA was extracted directly from the dressings and amplified in a specific nested PCR assay. Malassezia-specific DNA was detected in all samples obtained from 32 AD patients. In particular, Malassezia globosa and M. restricta were detected in approximately 90% of the AD patients and M. furfur and M. sympodialis were detected in approximately 40% of the cases. The detection rate was not dependent on the type of skin lesion. In healthy subjects, Malassezia DNA was detected in 78% of the samples, among which M. globosa, M. restricta, and M. sympodialis were detected at frequencies ranging from 44 to 61%, with M. furfur at 11%. The diversity of Malassezia species found in AD patients was greater (2.7 species detected in each individual) than that found in healthy subjects (1.8 species per individual). Our results suggest that M. furfur, M. globosa, M. restricta, and M. sympodialis are common inhabitants of the skin of both AD patients and healthy subjects, while the skin microflora of AD patients shows more diversity than that of healthy subjects. To our knowledge, this is the first report of the use of a nested PCR as an alternative to fungal culture for analysis of the distribution of cutaneous Malassezia spp.Members of the genus Malassezia, lipophilic yeasts, colonize the skin of the head, neck, and shoulders of humans and are one of the causative factors in pityriasis versicolor and seborrheic dermatitis (3). Malassezia species are also considered to be one of the factors that exacerbate atopic dermatitis (AD), based on the finding that AD patients (but not healthy subjects) have specific serum immunoglobulin E (IgE) antibodies against Malassezia spp. (9, 22, 23). Application of topical antimycotic agents to AD patients decreases Malassezia colonization and the severity of eczematous lesions (2), suggesting that Malassezia species play a role in AD. In addition, several candidate Malassezia antigens have been implicated in the pathogenesis of AD (10,11,16,17,19,24).The taxonomy of the genus Malassezia was recently revised, primarily by using rRNA gene sequences, into seven species: M. furfur, M. globosa, M. obtusa, M. restricta, M. pachydermatis, M. slooffiae, and M. sympodialis (4, 5, 6). M. globosa, M. obtusa, M. restricta, and M. slooffiae were formerly designated M. furfur. The frequency of isolation of each species and its correlation with the clinical manifestations of AD have not been well investigated. Studies examining colonization by Malassezia spp. may aid in the understanding of the mechanism of AD and the development of an effective treatment. Due to the difficulties inherent in culturing Malassezia spp., we analyzed the cutaneous Malassezia mi...

Atopic Eczema/Dermatitis Syndrome and <i>Malassezia</i>

“…M. globosa, Malassezia furfur and M. sympodialis have been most frequently isolated from seborrheic dermatitis patients [32, 33]. Concerning AEDS there are contradictory reports; in a Japanese study [32] M. furfur was the most common species cultured, whereas nested PCR used in another study from Japan showed that M. globosa and M. restricta could be detected on the skin in 90% of the AEDS patients, and M. sympodialis and M. furfur on 40% of the patients [34]. In studies from Canada, Russia and Sweden, M. sympodialis was reported as the most frequent species in both AEDS patients and healthy individuals [33, 35, 36].…”

Cutaneous <i>Malassezia</i> Microbiota in Atopic Dermatitis Patients Differ by Gender and Body Part

“…The taxonomy of genus Malassezia was revised in 1996 [12], and further new species have been reported in recent years [15,16,17,18,19]. There have been several studies concerning the frequency of isolation of each species and its correlation with the clinical manifestations of AD [20,21,22,23,24,25]. These previous studies used either nonculture or culture methods, and the differences by gender and body part of Malassezia species isolated from AD patients have not been thoroughly considered.…”

Trichosporonosis – An Association With Clinical Factors and Its Outcome

“…The first set of primers used were Trichosporongenus specific primers (TRF -5'AGAGCCTACCATGGTATCA 3' TRR-5'TAAGACCCAATAGAGCCCTA3') [19]. They would precisely amplify only Trichosporon species, by aligning with the small subunit (SSU) of ribosomal DNA (rDNA) sequences, since this region is not conserved in other medically important yeasts.…”

“…PCR was performed with Trichosporon genus specific primers to double check for accurate identification of the genus [19]. This pair of primer is Trichosporon specific and amplified part of the nucleotide sequences of the rDNA small subunit (18S).…”

“…They would precisely amplify only Trichosporon species, by aligning with the small subunit (SSU) of ribosomal DNA (rDNA) sequences, since this region is not conserved in other medically important yeasts. The PCR master mix was prepared containing 25μl of PCR mix (Takara, Japan), 1 μl of forward (TRF) and reverse primer each (TRR) (GeNei, Bangalore), 1 μl of template DNA and the volume made up to 50 μl with sterile nuclease-free water.The reaction mixtures were amplified in a thermal cycler (Veriti 96 well, Applied Biosystems, USA), with the following program: 95°C for 7 min, followed by 30 cycles consisting of 95°C for 30s, 54°C for 30s, and 72°C for 30s, with a final extension period at 72°C for 10min [19]. After thermal cycling, 10μlof the amplified product was run on a 1.5% (wt/vol) agarose gel, stained with ethidium bromide, and visualized with UV light.…”