Molecular Analysis of Phenol-Degrading Microbial Strains

Manasiev, Jordan; Gerginova, Maria; Yemendzhiev, Husein; Peneva, Nadejda; Alexieva, Zlatka

doi:10.1515/znc-2008-1-224

Cited by 3 publications

(5 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The presence of Burkholderia sp. K1 strain in our investigation was motivated by the ability of such strains to degrade aromatic compounds through the meta-cleavage pathway [10,13]. The used strain of Escherichia coli JM 109 was proven to be incapable to resist and degrade phenolic compounds.…”

Section: Resultsmentioning

confidence: 99%

“…The second oligonucleotide "OligoZA1" (5Ј-AGCTAT GATATTTTGATGGGCACGTTCCGCTCGCCCTACCT CTAC-3Ј) was designed earlier in our laboratory on the basis of TORCCMLE locus for cis,cis-muconate lactonizing enzyme (MLE) in T. cutaneum ATCC 58094 (NCBI) [10]. This oligonucleotide probe was used in the next set of The DNAs of both strains T. cutaneum and the investigated T. versicolor 1 displayed a positive hybridizing signal with "OligoZA1".…”

Section: Resultsmentioning

confidence: 99%

“…K1 strain, Escherichia coli JM 109. The microbial cultivation was carried out in accordance with common media and conditions typical for each one of the species [1,8,10,13,15].…”

Section: Microorganisms Growth Conditions and Analytical Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Growth of Trametes versicolor on phenol

Yemendzhiev

Gerginova

Krastanov

et al. 2008

J Ind Microbiol Biotechnol

View full text Add to dashboard Cite

Trametes versicolor 1 was shown to grow on phenol as its sole carbon and energy source. The culture growth and degradation ability dependence on culture medium pH value was observed. The optimal pH value of a liquid Czapek salt medium was 6.5. The investigated strain utilized completely 0.5 g/l phenol in 6 days. The dynamics of the phenol degradation process was investigated. The process was characterized by specific growth rate micromax 0.33 h(-1), metabolic coefficient k=4.4, yield coefficient Yx/s=0.23 and rate of degradation Q=0.506 h(-1). The intracellular activities of phenol hydroxylase (0.333 U/mg protein) and cis,cis-muconate lactonizing enzyme (0.41 U/mg protein) were demonstrated for the first time in this fungus. In an attempt to estimate the occurrence of gene sequences in T. versicolor 1 related to phenol degradation pathway a dot blot analysis with total DNA isolated from this strain was performed. Two synthetic oligonucleotides were used as hybridizing probes. One of the probes was homologous to the 5'end of phyA gene coding for phenol hydroxylase in Trichosporon cutaneum ATCC 46490. The other probe was created on the basis of cis,cis-muconate lactonizing enzyme coding gene in T. cutaneum ATCC 58094. The results of these investigations showed that T. versicolor 1 may carry genes similar to those of Trichosporon cutaneum capable to degrade phenol.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Growth of Trametes versicolor on phenol

Yemendzhiev

Gerginova

Krastanov

et al. 2008

J Ind Microbiol Biotechnol

View full text Add to dashboard Cite

show abstract

“…The fungal genomic DNA was extracted using the method of Kostadinova et al [ 29 ] and Manasiev et al [ 30 ] with some major modifications in other to simplify and reduce the extraction time, cost and stress. Liquid nitrogen, marcaptoethanol, and chloroform isoamyl-alcohol were not used in this procedure.…”

Section: Methodsmentioning

confidence: 99%

Synergistic rhizosphere degradation of γ-hexachlorocyclohexane (lindane) through the combinatorial plant-fungal action

2017

View full text Add to dashboard Cite

Fungi are usually involved in degradation/deterioration of many anthropogenic wastes due to their verse enzyme secretions and adaptive capabilities. In this study, five dominant fungal strains were isolated from an aged lindane polluted site, they were all mixed (100 mg each) together with pent mushroom compost (SMC) and applied to lindane polluted soil (5 kg) at 10, 20, 30, 40% and control 0% (soil with no treatment), these were used to grow M. maximus Jacq for 3 months. To establish lindane degradation, deductions such as Degradation rate (K1), Half-life (t1/2) and Degradation efficiency (DE) were made based on the analyzed lindane concentrations before and after the experiment. We also tested the presence and expressions of phosphoesterases (mpd and opd-A) and catechol 1,2-dioxygenases (efk2 and efk4) genes in the strains. The stains were identified as Aspergillus niger (KY693970); Talaromyces atroroseus (KY488464), Talaromyces purpurogenus (KY488468), Yarrowia lipolytica (KY488469) and Aspergillus flavus (KY693973) through morphological and molecular methods. Combined rhizospheric action of M. maximus and fungi speed up lindane degradation rate, initially detected lindane concentration of 45 mg/kg was reduced to 11.26, 9.34 and 11.23 mg/kg in 20, 30 and 40% treatments respectively making 79.76, 85.93 and 88.67% degradation efficiencies. K1 of 1.29 was recorded in control while higher K1 of 1.60, 1.96 and 2.18 /day were recorded in 20, 30 and 40% treatments respectively. The best t1/2 of 0.32 and 0.35 /day were recorded in 40 and 30% compared to control (0.54 /day). All the strains were also affirmed to possess the tested genes; opd was overexpressed in all the strains except KY693973 while mpd was overexpressed in KY693970, KY488464 but moderately expressed in KY488468, KY488469 and KY693973. However, efk genes were under-expressed in most of the strains except KY488469 and KY693973 which showed moderate expression of efk4. This work suggests that the synergistic association of the identified rhizospheric fungi and M. maximus roots could be used to remove lindane in soil at a limited time period and this combination could be used at large scale.

show abstract

“…Polymerase chain reaction (PCR) and DNA sequence analysis have been successfully applied in the study of genes involved in the catabolism of aromatic compounds (Okuta et al, 1998;Kahng and Oh, 2005;Manasiev et al, 2008). For example, the gene Cvmp encoding phenol mono-oxygenase in Chromobacterium violaceum was identifi ed by its homology (74% similarity and 59% identity) to the gene encoding phenol hydroxylase in the bacterium Ralstonia eutropha (Perpetuo et al, 2009).…”

Section: Introductionmentioning

confidence: 99%

Biodegradation of Phenol by Antarctic Strains of Aspergillus fumigatus

Gerginova¹,

Manasiev²,

Yemendzhiev³

et al. 2013

Z. Naturforsch. C

Self Cite

View full text Add to dashboard Cite

Taxonomic identification of three newly isolated Antarctic fungal strains by their 18S rDNA sequences revealed their affiliation with Aspergillus fumigatus. Phenol (0.5 g/l) as the sole carbon source was completely degraded by all strains within less than two weeks. Intracellular activities of three key enzymes involved in the phenol catabolism were determined. Activities of phenol hydroxylase (EC 1.14.13.7), hydroquinone hydroxylase (EC 1.14.13.x), and catechol 1,2-dioxygenase (EC 1.13.11.1) varied significantly between strains. The rates of phenol degradation in the three strains correlated best with the activity of catechol 1,2-dioxygenase. Six pairs of oligonucleotide primers were designed on the basis of the Aspergillus fumigatus Af293 genome sequence (NCBI Acc. No. XM_743491.1) and used to amplify phenol hydroxylase-related gene sequences. DNA sequences of about 1200 bp were amplified from all three strains and found to have a high degree of sequence identity with the corresponding gene of Aspergillus fumigatus Af293.

show abstract

Molecular Analysis of Phenol-Degrading Microbial Strains

Cited by 3 publications

References 27 publications

Growth of Trametes versicolor on phenol

Growth of Trametes versicolor on phenol

Synergistic rhizosphere degradation of γ-hexachlorocyclohexane (lindane) through the combinatorial plant-fungal action

Biodegradation of Phenol by Antarctic Strains of Aspergillus fumigatus

Contact Info

Product

Resources

About