Molecular and morphological characterization of Phyllactinia cassiae-fistulae (Erysiphaceae; Ascomycota) from Thailand

Monkhung, Sararat; Takamatsu, Susumu; To-anun, Chaiwat

doi:10.5897/ajb12.2355

Cited by 11 publications

(1 citation statement)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The 5’-end of the 28S rDNA (including D1 and D2 domains) and internal transcribed spacer (ITS) regions were amplified and sequenced. Primer sets Ph7 (TGTTGCTTTGGYAGGCCG; Monkhung, Takamatsu, & To-anun, 2013 )/NLP2 (GGTCCCAACAGCTATGCTCT; Mori, Sato, & Takamatsu, 2000 ) and ITS5 (GGAAGTAAAAGTCGTAACAAGG; White, Bruns, Lee, & Taylor, 1990 )/Ph8 (GCCCCAAGACCAAGCC; this study) were used for amplification of the 28S rDNA and ITS region, respectively. Ph8 was newly designed in this study based on the sequences of Phyllactinia spp.…”

Section: Methodsmentioning

confidence: 99%

Phylogeny and taxonomy of Phyllactinia species (powdery mildew: Erysiphaceae) occurring on the ash trees (Fraxinus spp.)

et al. 2021

View full text Add to dashboard Cite

The genus Fraxinus (Oleaceae), known as ash trees, currently comprises 43 recognized species that are distributed in temperate and subtropical regions of the Northern Hemisphere. Two Phyllactinia species, P. fraxini and P. fraxinicola, have been known on Fraxinus spp. so far. In this study, powdery mildews belonging to Phyllactinia were collected on Fraxinus spp. from different areas of the world to make molecular and morphological analyses. These specimens are divided into four distinct molecular phylogenetic groups, which are distinguishable by their morphology and/or host preference. Two new species, viz. P. japonica occurring on F. sieboldina and F. lanuginosa f. serrata, and P. fraxini-longicuspidis on F. longicuspis, are proposed in this study. An epitype is designated for P. fraxini. This study indicates very high host specificity among the four Phyllactinia species on Fraxinus, suggesting that genetic isolation by host specificity played a more important role than geographic segregation in the speciation events of these Phyllactinia species. Evolutionary timing calculated by molecular clock analysis suggests that these powdery mildews diverged in accordance with host phylogeny after divergence of host plants.

show abstract

Section: Methodsmentioning

confidence: 99%

Phylogeny and taxonomy of Phyllactinia species (powdery mildew: Erysiphaceae) occurring on the ash trees (Fraxinus spp.)

et al. 2021

View full text Add to dashboard Cite

show abstract

Appressorial interactions with host and their evolution

et al. 2021

View full text Add to dashboard Cite

Notes on powdery mildews (Erysiphales) in Thailand II. Erysiphe species on Adoxaceae Anacardiaceae, Apocynaceae, Araliaceae, Aristolochiaceae, Bixaceae, Brassicaceae, Cleomaceae, Convolvulaceae, Cucurbitaceae and Euphorbiacea

Meeboon

Takamatsu

2016

Trop. plant pathol.

View full text Add to dashboard Cite

The previous reports on powdery mildews from Thailand revealed some unknown species and also the importance of this area for the diversity, systematics and evolution of powdery mildews. This report provides an additional list consisting of three species of the genus Erysiphe and its asexual morph (Pseudoidium) on various hosts found in Thailand. Morphological descriptions of powdery mildew specimens on 11 plant families and molecular phylogenetic analyses based on ITS rDNA sequences are provided. We report 6 new host records for Erysiphe in the world, viz., Viburnum inopinatum (Adoxaceae), Wrightia arborea (Apocynaceae), Hydrocotyle javanica (Araliaceae), Cleome chelidonii (Cleomaceae), Luffa acutangula (Cucurbitaceae) and Ostodes paniculata (Euphorbiaceae). In addition, 10 new records of Erysiphe found in Thailand are described.

show abstract

Molecular and morphological characterization of Phyllactinia cassiae-fistulae (Erysiphaceae; Ascomycota) from Thailand

Cited by 11 publications

References 18 publications

Phylogeny and taxonomy of <i>Phyllactinia</i> species (powdery mildew: <i>Erysiphaceae</i>) occurring on the ash trees (<i>Fraxinus</i> spp.)

Phylogeny and taxonomy of <i>Phyllactinia</i> species (powdery mildew: <i>Erysiphaceae</i>) occurring on the ash trees (<i>Fraxinus</i> spp.)

Appressorial interactions with host and their evolution

Notes on powdery mildews (Erysiphales) in Thailand II. Erysiphe species on Adoxaceae Anacardiaceae, Apocynaceae, Araliaceae, Aristolochiaceae, Bixaceae, Brassicaceae, Cleomaceae, Convolvulaceae, Cucurbitaceae and Euphorbiacea

Contact Info

Product

Resources

About