Molecular and phenotypic variations in Eutetranychus orientalis (Klein) populations from Saudi Arabia

Abstract

The oriental red spider mite, Eutetranychus orientalis (Klein) is a major pest of citrus in many countries including Saudi Arabia (SA). The morphological variations among the different populations of E. orientalis were reported. In the present study, phenotypic variations based on 40 different morphological characteristics were evaluated in 10 E. orientalis populations collected from different hosts and regions of SA. Further, ITS2-rDNA sequences were used to confirm the identity of these phenotypically varying populations. Phenotypic variations in all populations were found in the shape and length of dorsal setae, striation pattern between setae d1 and e1, and leg chaetotaxy. The rDNA sequence analysis of these morphologically varying populations resulted in 10 different ITS2 Saudi haplotypes. The phenotypic and genetic variations were more related to the host plants rather than their geographic distribution. The E. orientalis population collected from Phoenix dactylifera was phenotypically distinct and genetically divergent. The populations collected from citrus species were also more phenotypically and genetically related to each other than to populations collected from non-citrus host plants. The haplotypes recovered from Ziziphus sp., Morus sp., and Azadirecta indica from different regions were grouped in the same sub-clade. Further, the ITS2 haplotypes of Saudi E. orientalis recovered from Citrus reticulata from Riyadh and Al Ula were 100% identical to the ITS2 haplotypes recovered from Citrus sp. from Israel. It is concluded that phenotypic variations exist among different populations of E. orientalis inhabiting different host plants. This species should be identified carefully by considering phenotypic intraspecific variations.

Evidence for Reconsidering the Taxonomic Status of Closely Related Oligonychus Species in punicae Complex (Acari: Prostigmata: Tetranychidae)

“…The molecular data obtained from the ITS2 and COI sequences support the synonymy of O. mangiferus with O. punicae . The obtained intraspecific range (0% to 2.1%;) of the nucleotide diversity using the ITS2 sequences of the punicae complex from Egypt, Israel, India, Pakistan, and SA, aligns well with previous findings on different tetranychid species [ 29 , 31 , 34 , 35 , 54 ]. Previously, the ITS2-intraspecific sequence divergence ranged between 0% and 2% (≤2%) in various tetranychid species, including the three Oligonychus species of O. afrasiaticus (McGregor) , O. mangiferus , and O. perseae (Tuttle, Baker and Abbatiello).…”

“…Previously, the ITS2-intraspecific sequence divergence ranged between 0% and 2% (≤2%) in various tetranychid species, including the three Oligonychus species of O. afrasiaticus (McGregor) , O. mangiferus , and O. perseae (Tuttle, Baker and Abbatiello). Moreover, a 0% to 0.4% [ 54 ] and 0.2% to 2.5% [ 31 ] intraspecific ITS2-sequence divergence was detected among various populations of Mononychellys progresivus (Dorest) and Eutetranychus orientalis (Klein), respectively.…”

“…DNA-based markers, e.g. the internal transcribed spacer region ITS2 of the nuclear ribosomal DNA and the mitochondrial cytochrome c oxidase subunit I (COI) gene have been applied accurately together with morphological data for the identification and confirmation of morphologically related tetranychid species [ 26 , 28 , 29 , 30 , 31 , 32 ]. The application of integrative taxonomy for species delineation has resolved many problems of synonymy and the misidentification of closely related species in the family Tetranychidae [ 33 , 34 , 35 ].…”

Updated and annotated review of Tetranychidae occurring in mainland Portugal, the Azores, and Madeira Archipelagos

“…Primers ITS2-F (5 ′ GTCACATCTGTCTGAGAGTTGAGA3 ′ ) and the degenerate ITS2-R (5 ′ GTARCCTCACCTRMTCTGAGATC3 ′ ) (Ben David et al 2007; Mirza et al 2020 and primers COI-F (5 ′ TTYGAYCCWAGAGGAGGAGG3 ′ ) and COI-R (5 ′ AAACCTARAAAATGTTGWGG3 ′ ) (Matsuda et al 2013) were used for the PCR. PCR reactions were performed in a 50 µl final volume using the AccuStart II Taq DNA Polymerase kit (Quanta Biosciences) and the PCR cycling conditions as reported previously by Mirza et al (2020). PCR products were cleaned with ExoSAP reagent (Thermo Fisher Scientific) and directly sequenced in both directions using the same primers at INIAV Sequencing Laboratory (Lisbon, Portugal) on a DNA analyser ABI PRISM 3730xl (Applied Biosystems).…”

Molecular-Based Taxonomic Inferences of Some Spider Mite Species of the Genus Oligonychus Berlese (Acari, Prostigmata, Tetranychidae)

“…The mitochondrial cytochrome c oxidase subunit I (COI) gene has been used extensively in identifying organisms, including mites [ 7 , 12 , 13 , 14 , 15 ]. The internal transcribed spacers (ITS1 and ITS2) regions of nuclear ribosomal DNA have also been applied accurately for the identification or confirmation of closely related species in the family Tetranychidae Donnadieu [ 7 , 13 , 14 , 16 , 17 ]. The combined use of morphological- and molecular-based methods for species delineation would greatly help resolve problems of synonymy and the misidentification of closely related tetranychid species [ 18 , 19 , 20 ].…”