Molecular Characterization of New Haplotype of Genus Sarcocystis in Seabirds from Magdalena Island, Southern Chile

Abstract

Evidence of sarcocystid infection was investigated in samples of 16 penguins (Spheniscus. magellanicus), four Dominican gulls (Larus dominicanus) and two Chilean skuas (Stercorarius chilensis) found in Madalenas Islands, Chile, in 2017. Samples of skeletal muscle, cardiac muscle and brain from all birds were screened by a pan-sarcocystid nested-PCR targeting a short fragment of the gene encoding the small ribosomal unit (nPCR-18Sa). The only two positive samples by nPCR-18Sa, both from skuas, were tested by a nested-PCR directed to the internal transcribed spacer 1 (nPCR-ITS1), also a pan-sarcocystidae nested-PCR, and to a nested-PCR directed to the B1 gene (nPCR-B1), for the exclusive detection of Toxoplasma gondii. The two nPCR-18Sa-positive samples were nPCR-ITS1-positive and nPCR-B1-negative. The nPCR-ITS1 nucleotide sequences from the two skuas, which were identical to each other, were revealed closely related to homologous sequences of Sarcocystis halieti, species found in seabirds of northern hemisphere. Larger fragments of genes encoding 18S and partial sequences of genes coding for cytochrome oxidase subunit 1 were also analyzed, corroborating ITS1 data. The haplotypes found in the skuas are unprecedent and closely related to species that use birds as the definitive host. Further studies need to be carried out to detect, identify and isolate this parasite to understand the epidemiology of the infection and its impact on the health of marine fauna.

Epidemiological risk factors and phylogenetic affinities of Sarcocystis infecting village chickens and pigs in Peninsular Malaysia

“…studies infecting avian species (Gjerde et al, 2018;Prakas et al, 2023). This is because the ITS1 gene has a more variable locus owing to the higher amount of indels such as insertions and/or deletions than the 18S rRNA gene, hence containing more important phylogenetic data to differentiate species within the genus (Acosta et al, 2021;Prakas et al, 2023). Sarcocystis wenzeli infection in this study was confirmed by ITS1 gene sequencing and phylogenetic trees; the analyses revealed six variants clustered with those from China and Brazil.…”

Role of three bird species in the life cycle of two Sarcocystis spp. (Apicomplexa, Sarcocystidae) in the Czech Republic

“…Similarly, Sarcocystis sp. in the Chilean skua ( Stercorarius chilensis [Bonaparte, 1857]) from Chile (see Acosta et al, 2021 ; Prakas et al, 2021 ) also formed a sister branch. Our phylogenetic analysis showed similar branching, so it is difficult to state whether these sequences belong to the same species, until more samples are molecularly obtained.…”

Far-East Asian Toxoplasma isolates share ancestry with North and South/Central American recombinant lineages

“…The cardiac apex (approximately 10~20 g) was added to 150 ml of tissue lysate, mixed until liquid using a mixer, and then dissolved with Proteinase K at 56 °C overnight. The next morning, DNA was extracted using Qiagen's DNeasy Blood & Tissue kit and nested-PCR targeting the B1 gene of T. gondii was performed 62 . The oligonucleotides corresponding to the B1 gene were as follows: B1-T1: AGCGTCTCTCTT CAAGCAGCGTA, B1-T2: TCCGCAGCGACTTCTATCTCTCTGT, B1-T3: TGGGAATGAAAGAGACGCTAATGTG, B1-T4: TTAAAGCGTTCGTGGT CAACTATCG.…”